ID: 962477414

View in Genome Browser
Species Human (GRCh38)
Location 3:135767552-135767574
Sequence GAACCCTGATTGGCCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962477414_962477416 -4 Left 962477414 3:135767552-135767574 CCTGCTTTGGCCAATCAGGGTTC No data
Right 962477416 3:135767571-135767593 GTTCAGCTCTATTGACAAATTGG No data
962477414_962477417 -3 Left 962477414 3:135767552-135767574 CCTGCTTTGGCCAATCAGGGTTC No data
Right 962477417 3:135767572-135767594 TTCAGCTCTATTGACAAATTGGG No data
962477414_962477418 -2 Left 962477414 3:135767552-135767574 CCTGCTTTGGCCAATCAGGGTTC No data
Right 962477418 3:135767573-135767595 TCAGCTCTATTGACAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962477414 Original CRISPR GAACCCTGATTGGCCAAAGC AGG (reversed) Intergenic
No off target data available for this crispr