ID: 962477417

View in Genome Browser
Species Human (GRCh38)
Location 3:135767572-135767594
Sequence TTCAGCTCTATTGACAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962477409_962477417 21 Left 962477409 3:135767528-135767550 CCTGAACCATTCAATCAGAGCTC No data
Right 962477417 3:135767572-135767594 TTCAGCTCTATTGACAAATTGGG No data
962477414_962477417 -3 Left 962477414 3:135767552-135767574 CCTGCTTTGGCCAATCAGGGTTC No data
Right 962477417 3:135767572-135767594 TTCAGCTCTATTGACAAATTGGG No data
962477410_962477417 15 Left 962477410 3:135767534-135767556 CCATTCAATCAGAGCTCACCTGC No data
Right 962477417 3:135767572-135767594 TTCAGCTCTATTGACAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962477417 Original CRISPR TTCAGCTCTATTGACAAATT GGG Intergenic
No off target data available for this crispr