ID: 962479335

View in Genome Browser
Species Human (GRCh38)
Location 3:135785352-135785374
Sequence AGGGAGAACTGCATAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962479329_962479335 12 Left 962479329 3:135785317-135785339 CCTTCATCTTTATGGTCCTATCA No data
Right 962479335 3:135785352-135785374 AGGGAGAACTGCATAGCTCCAGG No data
962479331_962479335 -4 Left 962479331 3:135785333-135785355 CCTATCATTGCCAGCCTGTAGGG No data
Right 962479335 3:135785352-135785374 AGGGAGAACTGCATAGCTCCAGG No data
962479327_962479335 20 Left 962479327 3:135785309-135785331 CCTTCATACCTTCATCTTTATGG No data
Right 962479335 3:135785352-135785374 AGGGAGAACTGCATAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962479335 Original CRISPR AGGGAGAACTGCATAGCTCC AGG Intergenic
No off target data available for this crispr