ID: 962481223

View in Genome Browser
Species Human (GRCh38)
Location 3:135800355-135800377
Sequence GGCTGATGTGCCCTAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962481223_962481227 -8 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481227 3:135800370-135800392 CATCAGCCCATGCAGGGAAATGG No data
962481223_962481230 16 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data
962481223_962481233 21 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481233 3:135800399-135800421 TCTCTCCAGCACCATAGGCAGGG No data
962481223_962481232 20 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481232 3:135800398-135800420 CTCTCTCCAGCACCATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962481223 Original CRISPR GGCTGATGTGCCCTAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr