ID: 962481224 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:135800359-135800381 |
Sequence | CATGGGCTGATGTGCCCTAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
962481224_962481232 | 16 | Left | 962481224 | 3:135800359-135800381 | CCACTAGGGCACATCAGCCCATG | No data | ||
Right | 962481232 | 3:135800398-135800420 | CTCTCTCCAGCACCATAGGCAGG | No data | ||||
962481224_962481230 | 12 | Left | 962481224 | 3:135800359-135800381 | CCACTAGGGCACATCAGCCCATG | No data | ||
Right | 962481230 | 3:135800394-135800416 | AAGCCTCTCTCCAGCACCATAGG | No data | ||||
962481224_962481233 | 17 | Left | 962481224 | 3:135800359-135800381 | CCACTAGGGCACATCAGCCCATG | No data | ||
Right | 962481233 | 3:135800399-135800421 | TCTCTCCAGCACCATAGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
962481224 | Original CRISPR | CATGGGCTGATGTGCCCTAG TGG (reversed) | Intergenic | ||