ID: 962481227

View in Genome Browser
Species Human (GRCh38)
Location 3:135800370-135800392
Sequence CATCAGCCCATGCAGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962481223_962481227 -8 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481227 3:135800370-135800392 CATCAGCCCATGCAGGGAAATGG No data
962481219_962481227 20 Left 962481219 3:135800327-135800349 CCTGACAGCTGGTACACTGGCAG No data
Right 962481227 3:135800370-135800392 CATCAGCCCATGCAGGGAAATGG No data
962481222_962481227 -3 Left 962481222 3:135800350-135800372 CCTCACCTGCCACTAGGGCACAT No data
Right 962481227 3:135800370-135800392 CATCAGCCCATGCAGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962481227 Original CRISPR CATCAGCCCATGCAGGGAAA TGG Intergenic
No off target data available for this crispr