ID: 962481230

View in Genome Browser
Species Human (GRCh38)
Location 3:135800394-135800416
Sequence AAGCCTCTCTCCAGCACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962481228_962481230 -5 Left 962481228 3:135800376-135800398 CCCATGCAGGGAAATGGCAAGCC No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data
962481222_962481230 21 Left 962481222 3:135800350-135800372 CCTCACCTGCCACTAGGGCACAT No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data
962481224_962481230 12 Left 962481224 3:135800359-135800381 CCACTAGGGCACATCAGCCCATG No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data
962481229_962481230 -6 Left 962481229 3:135800377-135800399 CCATGCAGGGAAATGGCAAGCCT No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data
962481223_962481230 16 Left 962481223 3:135800355-135800377 CCTGCCACTAGGGCACATCAGCC No data
Right 962481230 3:135800394-135800416 AAGCCTCTCTCCAGCACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962481230 Original CRISPR AAGCCTCTCTCCAGCACCAT AGG Intergenic
No off target data available for this crispr