ID: 962482032

View in Genome Browser
Species Human (GRCh38)
Location 3:135806305-135806327
Sequence CATTCCAAGCGGACTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962482024_962482032 28 Left 962482024 3:135806254-135806276 CCAGTCTACAAGATGTAGCAGAT No data
Right 962482032 3:135806305-135806327 CATTCCAAGCGGACTCCCTGGGG No data
962482027_962482032 -3 Left 962482027 3:135806285-135806307 CCAGAAAGGATCGACATGTCCAT No data
Right 962482032 3:135806305-135806327 CATTCCAAGCGGACTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962482032 Original CRISPR CATTCCAAGCGGACTCCCTG GGG Intergenic
No off target data available for this crispr