ID: 962483214

View in Genome Browser
Species Human (GRCh38)
Location 3:135815812-135815834
Sequence AGGGAGAATGCAGTGATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962483204_962483214 22 Left 962483204 3:135815767-135815789 CCCTGGCAGCAGCCGCCTGGTGT No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483205_962483214 21 Left 962483205 3:135815768-135815790 CCTGGCAGCAGCCGCCTGGTGTA No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483207_962483214 7 Left 962483207 3:135815782-135815804 CCTGGTGTAGAGAATCTGTGTGC No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483206_962483214 10 Left 962483206 3:135815779-135815801 CCGCCTGGTGTAGAGAATCTGTG No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483201_962483214 29 Left 962483201 3:135815760-135815782 CCCTTTACCCTGGCAGCAGCCGC No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483200_962483214 30 Left 962483200 3:135815759-135815781 CCCCTTTACCCTGGCAGCAGCCG No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data
962483202_962483214 28 Left 962483202 3:135815761-135815783 CCTTTACCCTGGCAGCAGCCGCC No data
Right 962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962483214 Original CRISPR AGGGAGAATGCAGTGATCAT GGG Intergenic
No off target data available for this crispr