ID: 962485734

View in Genome Browser
Species Human (GRCh38)
Location 3:135840552-135840574
Sequence TGTAACATAAGATCACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962485734_962485740 23 Left 962485734 3:135840552-135840574 CCATTATGTGATCTTATGTTACA No data
Right 962485740 3:135840598-135840620 TACATTGGCTACATTTGTGAGGG No data
962485734_962485737 8 Left 962485734 3:135840552-135840574 CCATTATGTGATCTTATGTTACA No data
Right 962485737 3:135840583-135840605 GATTACTGCTTGTCCTACATTGG No data
962485734_962485739 22 Left 962485734 3:135840552-135840574 CCATTATGTGATCTTATGTTACA No data
Right 962485739 3:135840597-135840619 CTACATTGGCTACATTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962485734 Original CRISPR TGTAACATAAGATCACATAA TGG (reversed) Intergenic
No off target data available for this crispr