ID: 962487397

View in Genome Browser
Species Human (GRCh38)
Location 3:135857977-135857999
Sequence CACGCCACTGCTGGGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962487397_962487402 9 Left 962487397 3:135857977-135857999 CCCTGTCACCCAGCAGTGGCGTG No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487397_962487401 8 Left 962487397 3:135857977-135857999 CCCTGTCACCCAGCAGTGGCGTG No data
Right 962487401 3:135858008-135858030 TCACTGCAACCTCTGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962487397 Original CRISPR CACGCCACTGCTGGGTGACA GGG (reversed) Intergenic