ID: 962487398

View in Genome Browser
Species Human (GRCh38)
Location 3:135857978-135858000
Sequence TCACGCCACTGCTGGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962487398_962487402 8 Left 962487398 3:135857978-135858000 CCTGTCACCCAGCAGTGGCGTGA No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487398_962487401 7 Left 962487398 3:135857978-135858000 CCTGTCACCCAGCAGTGGCGTGA No data
Right 962487401 3:135858008-135858030 TCACTGCAACCTCTGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962487398 Original CRISPR TCACGCCACTGCTGGGTGAC AGG (reversed) Intergenic