ID: 962487399

View in Genome Browser
Species Human (GRCh38)
Location 3:135857985-135858007
Sequence GCTGTGATCACGCCACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962487399_962487402 1 Left 962487399 3:135857985-135858007 CCCAGCAGTGGCGTGATCACAGC No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487399_962487401 0 Left 962487399 3:135857985-135858007 CCCAGCAGTGGCGTGATCACAGC No data
Right 962487401 3:135858008-135858030 TCACTGCAACCTCTGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962487399 Original CRISPR GCTGTGATCACGCCACTGCT GGG (reversed) Intergenic