ID: 962487400

View in Genome Browser
Species Human (GRCh38)
Location 3:135857986-135858008
Sequence AGCTGTGATCACGCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962487400_962487401 -1 Left 962487400 3:135857986-135858008 CCAGCAGTGGCGTGATCACAGCT No data
Right 962487401 3:135858008-135858030 TCACTGCAACCTCTGCCTCCCGG No data
962487400_962487402 0 Left 962487400 3:135857986-135858008 CCAGCAGTGGCGTGATCACAGCT No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962487400 Original CRISPR AGCTGTGATCACGCCACTGC TGG (reversed) Intergenic