ID: 962487402

View in Genome Browser
Species Human (GRCh38)
Location 3:135858009-135858031
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962487399_962487402 1 Left 962487399 3:135857985-135858007 CCCAGCAGTGGCGTGATCACAGC No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487398_962487402 8 Left 962487398 3:135857978-135858000 CCTGTCACCCAGCAGTGGCGTGA No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487397_962487402 9 Left 962487397 3:135857977-135857999 CCCTGTCACCCAGCAGTGGCGTG No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data
962487400_962487402 0 Left 962487400 3:135857986-135858008 CCAGCAGTGGCGTGATCACAGCT No data
Right 962487402 3:135858009-135858031 CACTGCAACCTCTGCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type