ID: 962491291

View in Genome Browser
Species Human (GRCh38)
Location 3:135896544-135896566
Sequence CATTGTGTGGAGAAACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962491284_962491291 17 Left 962491284 3:135896504-135896526 CCCAGGGGGCTAGGAACTCTGTA No data
Right 962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG No data
962491285_962491291 16 Left 962491285 3:135896505-135896527 CCAGGGGGCTAGGAACTCTGTAG No data
Right 962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962491291 Original CRISPR CATTGTGTGGAGAAACTGGA GGG Intergenic
No off target data available for this crispr