ID: 962493049

View in Genome Browser
Species Human (GRCh38)
Location 3:135911954-135911976
Sequence CAGGGATCCTTGAGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962493049_962493058 8 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493049_962493054 4 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493049_962493051 -10 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493051 3:135911967-135911989 AGGATCCCTGATGGTCCCTGAGG No data
962493049_962493057 7 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962493049 Original CRISPR CAGGGATCCTTGAGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr