ID: 962493054

View in Genome Browser
Species Human (GRCh38)
Location 3:135911981-135912003
Sequence TCCCTGAGGATACTTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962493040_962493054 27 Left 962493040 3:135911931-135911953 CCCCTACCCCAGCCACCATGGAG No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493042_962493054 25 Left 962493042 3:135911933-135911955 CCTACCCCAGCCACCATGGAGCC No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493046_962493054 15 Left 962493046 3:135911943-135911965 CCACCATGGAGCCTGTTTTTCTC No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493043_962493054 21 Left 962493043 3:135911937-135911959 CCCCAGCCACCATGGAGCCTGTT No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493045_962493054 19 Left 962493045 3:135911939-135911961 CCAGCCACCATGGAGCCTGTTTT No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493041_962493054 26 Left 962493041 3:135911932-135911954 CCCTACCCCAGCCACCATGGAGC No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493044_962493054 20 Left 962493044 3:135911938-135911960 CCCAGCCACCATGGAGCCTGTTT No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493038_962493054 30 Left 962493038 3:135911928-135911950 CCACCCCTACCCCAGCCACCATG No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493047_962493054 12 Left 962493047 3:135911946-135911968 CCATGGAGCCTGTTTTTCTCAAG No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data
962493049_962493054 4 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493054 3:135911981-135912003 TCCCTGAGGATACTTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962493054 Original CRISPR TCCCTGAGGATACTTCCTGC AGG Intergenic
No off target data available for this crispr