ID: 962493057

View in Genome Browser
Species Human (GRCh38)
Location 3:135911984-135912006
Sequence CTGAGGATACTTCCTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962493046_962493057 18 Left 962493046 3:135911943-135911965 CCACCATGGAGCCTGTTTTTCTC No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493043_962493057 24 Left 962493043 3:135911937-135911959 CCCCAGCCACCATGGAGCCTGTT No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493042_962493057 28 Left 962493042 3:135911933-135911955 CCTACCCCAGCCACCATGGAGCC No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493049_962493057 7 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493044_962493057 23 Left 962493044 3:135911938-135911960 CCCAGCCACCATGGAGCCTGTTT No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493045_962493057 22 Left 962493045 3:135911939-135911961 CCAGCCACCATGGAGCCTGTTTT No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493040_962493057 30 Left 962493040 3:135911931-135911953 CCCCTACCCCAGCCACCATGGAG No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493047_962493057 15 Left 962493047 3:135911946-135911968 CCATGGAGCCTGTTTTTCTCAAG No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data
962493041_962493057 29 Left 962493041 3:135911932-135911954 CCCTACCCCAGCCACCATGGAGC No data
Right 962493057 3:135911984-135912006 CTGAGGATACTTCCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962493057 Original CRISPR CTGAGGATACTTCCTGCAGG TGG Intergenic
No off target data available for this crispr