ID: 962493058

View in Genome Browser
Species Human (GRCh38)
Location 3:135911985-135912007
Sequence TGAGGATACTTCCTGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962493045_962493058 23 Left 962493045 3:135911939-135911961 CCAGCCACCATGGAGCCTGTTTT No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493043_962493058 25 Left 962493043 3:135911937-135911959 CCCCAGCCACCATGGAGCCTGTT No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493044_962493058 24 Left 962493044 3:135911938-135911960 CCCAGCCACCATGGAGCCTGTTT No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493046_962493058 19 Left 962493046 3:135911943-135911965 CCACCATGGAGCCTGTTTTTCTC No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493049_962493058 8 Left 962493049 3:135911954-135911976 CCTGTTTTTCTCAAGGATCCCTG No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493052_962493058 -10 Left 962493052 3:135911972-135911994 CCCTGATGGTCCCTGAGGATACT No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493047_962493058 16 Left 962493047 3:135911946-135911968 CCATGGAGCCTGTTTTTCTCAAG No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493042_962493058 29 Left 962493042 3:135911933-135911955 CCTACCCCAGCCACCATGGAGCC No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data
962493041_962493058 30 Left 962493041 3:135911932-135911954 CCCTACCCCAGCCACCATGGAGC No data
Right 962493058 3:135911985-135912007 TGAGGATACTTCCTGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962493058 Original CRISPR TGAGGATACTTCCTGCAGGT GGG Intergenic
No off target data available for this crispr