ID: 962494982

View in Genome Browser
Species Human (GRCh38)
Location 3:135930242-135930264
Sequence AATCATCCTGAATCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962494982_962494987 23 Left 962494982 3:135930242-135930264 CCCTGCCCAGATTCAGGATGATT No data
Right 962494987 3:135930288-135930310 TTTCCAACATGACAAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962494982 Original CRISPR AATCATCCTGAATCTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr