ID: 962497928

View in Genome Browser
Species Human (GRCh38)
Location 3:135961580-135961602
Sequence GTTCAGCAGCAACATGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962497928_962497929 5 Left 962497928 3:135961580-135961602 CCTACATCATGTTGCTGCTGAAC No data
Right 962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962497928 Original CRISPR GTTCAGCAGCAACATGATGT AGG (reversed) Intergenic