ID: 962497928 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:135961580-135961602 |
| Sequence | GTTCAGCAGCAACATGATGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962497928_962497929 | 5 | Left | 962497928 | 3:135961580-135961602 | CCTACATCATGTTGCTGCTGAAC | No data | ||
| Right | 962497929 | 3:135961608-135961630 | CTCTGATTTAATGTCTCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962497928 | Original CRISPR | GTTCAGCAGCAACATGATGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||