ID: 962497929

View in Genome Browser
Species Human (GRCh38)
Location 3:135961608-135961630
Sequence CTCTGATTTAATGTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962497927_962497929 8 Left 962497927 3:135961577-135961599 CCTCCTACATCATGTTGCTGCTG No data
Right 962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG No data
962497926_962497929 29 Left 962497926 3:135961556-135961578 CCAAAGTATCTGCAGAATGTACC No data
Right 962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG No data
962497925_962497929 30 Left 962497925 3:135961555-135961577 CCCAAAGTATCTGCAGAATGTAC No data
Right 962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG No data
962497928_962497929 5 Left 962497928 3:135961580-135961602 CCTACATCATGTTGCTGCTGAAC No data
Right 962497929 3:135961608-135961630 CTCTGATTTAATGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962497929 Original CRISPR CTCTGATTTAATGTCTCCTT TGG Intergenic
No off target data available for this crispr