ID: 962498579

View in Genome Browser
Species Human (GRCh38)
Location 3:135966318-135966340
Sequence AAGTCGGGCCGAGGTTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962498579_962498590 14 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498590 3:135966355-135966377 GTGTCACCAGCTCCGGGCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 109
962498579_962498589 8 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498589 3:135966349-135966371 AAGGATGTGTCACCAGCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 198
962498579_962498592 19 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498592 3:135966360-135966382 ACCAGCTCCGGGCCGCGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 89
962498579_962498591 18 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498591 3:135966359-135966381 CACCAGCTCCGGGCCGCGGACGG 0: 1
1: 0
2: 0
3: 8
4: 122
962498579_962498595 27 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498595 3:135966368-135966390 CGGGCCGCGGACGGGATTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 78
962498579_962498588 7 Left 962498579 3:135966318-135966340 CCTGCCCAACCTCGGCCCGACTT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 962498588 3:135966348-135966370 GAAGGATGTGTCACCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962498579 Original CRISPR AAGTCGGGCCGAGGTTGGGC AGG (reversed) Intronic