ID: 962499309

View in Genome Browser
Species Human (GRCh38)
Location 3:135973786-135973808
Sequence CTAATTTATCACTATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962499309 Original CRISPR CTAATTTATCACTATGTGCC AGG Intronic
901909062 1:12439701-12439723 CTTACTTAGCACTATTTGCCAGG - Intronic
902131102 1:14261318-14261340 CTGATTTATTCCTCTGTGCCAGG - Intergenic
902594918 1:17502786-17502808 CTTATTTATACCTATTTGCCTGG - Intergenic
903439077 1:23373826-23373848 CTAATCAGTCACTATGTGTCAGG + Intergenic
903469558 1:23576408-23576430 TTCATGTAACACTATGTGCCAGG + Intergenic
904539947 1:31226069-31226091 CTTATCAAGCACTATGTGCCAGG - Intronic
905586931 1:39127381-39127403 TTAATTTCTTACTATGTGCCAGG + Intronic
906946001 1:50294898-50294920 CTAAGTGCTCACTATGTTCCAGG - Intergenic
907381516 1:54094706-54094728 TTTATTCAGCACTATGTGCCAGG - Intronic
908061840 1:60358561-60358583 CTGAATTATCAATATATGCCAGG + Intergenic
908583137 1:65539266-65539288 TTAATTTATCCCTGTGTCCCTGG + Intronic
908857000 1:68441903-68441925 CTGAGCTTTCACTATGTGCCAGG + Intronic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
910545453 1:88410988-88411010 CTAATTTACCAGTATGTAGCAGG + Intergenic
910705136 1:90121596-90121618 TTAAGTAATTACTATGTGCCAGG + Intergenic
910818826 1:91323490-91323512 CTTATTTATTACTATGTGATAGG - Intronic
911448039 1:98024318-98024340 CTAATTTATCTCTATCTCCTTGG + Intergenic
911475808 1:98370858-98370880 CTAATCACTCACCATGTGCCAGG + Intergenic
912768154 1:112435374-112435396 CTTATTTACCACTATATCCCAGG + Intronic
914800172 1:150955785-150955807 CTAAGTGATTACTATGTGCCAGG - Intronic
916514620 1:165504228-165504250 GTAATTTATTCCCATGTGCCAGG - Intergenic
916804898 1:168249927-168249949 CTTATCTAGTACTATGTGCCCGG + Exonic
917350851 1:174076242-174076264 CTAAATTATCTATATATGCCTGG + Intergenic
917919423 1:179738019-179738041 CAGATTTATCACTCTGTGCCTGG - Intergenic
921376422 1:214478679-214478701 TTAAATGATTACTATGTGCCAGG + Intronic
922129400 1:222762107-222762129 CTAAATACTTACTATGTGCCAGG + Intergenic
922914678 1:229247223-229247245 CTAATTTGGCTCTATGTACCAGG + Intergenic
923089174 1:230726181-230726203 GTTATTGATGACTATGTGCCAGG + Intergenic
924202111 1:241671286-241671308 ATACTTTATCACTAGGTGTCGGG + Intronic
1064277594 10:13920901-13920923 ATCAATTCTCACTATGTGCCAGG + Intronic
1064517879 10:16169892-16169914 CTCATTTATCATGATGTTCCTGG - Intergenic
1064710858 10:18123039-18123061 CTAAGTGCTCACTATGTACCAGG - Intergenic
1067609161 10:47694712-47694734 CAAATTTTTCAGTATGGGCCGGG - Intergenic
1067899297 10:50221851-50221873 CTCATTTATCTTTATGTTCCTGG - Intronic
1068012658 10:51473502-51473524 CTAATGTATGACTATCTACCAGG - Intronic
1068282960 10:54900122-54900144 CTTATTGATCACTATATACCAGG + Intronic
1068588887 10:58833088-58833110 CTAATTTAACAGTATATACCAGG - Intergenic
1068976975 10:63020807-63020829 CTAAATTTTCTCTAGGTGCCTGG - Intergenic
1069819852 10:71220712-71220734 CTGAGTGATCACTGTGTGCCGGG - Intronic
1069985270 10:72278633-72278655 TTAGTTAACCACTATGTGCCAGG - Intergenic
1070391511 10:75974804-75974826 GTAAACTCTCACTATGTGCCAGG - Intronic
1070982380 10:80659989-80660011 CTAATTCACCTCTATGTTCCCGG - Intergenic
1071745335 10:88412263-88412285 CTATTATTTTACTATGTGCCAGG + Intronic
1075525305 10:123179503-123179525 TTGAGTTATCACTATATGCCAGG - Intergenic
1076429619 10:130392384-130392406 TTAAGTGCTCACTATGTGCCGGG - Intergenic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1079360411 11:19766041-19766063 CTGATTGACCACTAAGTGCCAGG - Intronic
1079602882 11:22331247-22331269 CTAAGTTATGACTATGTGCCCGG - Intergenic
1079884903 11:25975251-25975273 CTAAGTTATCAATGTGTGCGAGG - Intergenic
1080036279 11:27715085-27715107 ATAATTTGCCATTATGTGCCAGG - Intronic
1081065686 11:38536558-38536580 CTAATTAATCACAGTGTTCCTGG - Intergenic
1081538888 11:44015909-44015931 ATAATTTATTACTACATGCCAGG - Intergenic
1081663124 11:44900579-44900601 CTGAGTTCTTACTATGTGCCAGG - Intronic
1081913087 11:46713112-46713134 GTAATTGCTCACCATGTGCCAGG - Intergenic
1084160978 11:67349999-67350021 CTAAGCACTCACTATGTGCCAGG - Intronic
1085381411 11:76122516-76122538 CTTATTTATTACTAAGTGCCAGG - Intronic
1086582792 11:88418590-88418612 CTGTTTTAGCACTCTGTGCCAGG + Intergenic
1086961809 11:92985587-92985609 CTAAGTGCTCACTATATGCCAGG + Intergenic
1088335366 11:108697977-108697999 CTAATTTAGCCTTATGTGCCTGG + Intronic
1088547558 11:110975182-110975204 TTAAACTTTCACTATGTGCCAGG - Intergenic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1089813279 11:121149022-121149044 CTTAGCTCTCACTATGTGCCAGG + Intronic
1090454241 11:126834069-126834091 CTACTTTATAATTATGTACCAGG + Intronic
1090529955 11:127580228-127580250 TTGAATTATCACTATGTGCCAGG - Intergenic
1090949790 11:131463510-131463532 CTAAATATTCACCATGTGCCTGG - Intronic
1091906807 12:4195668-4195690 CTTATTTATCAGTTTGTGGCTGG - Intergenic
1091925909 12:4348777-4348799 CTAAATTATTTCTATGTGACAGG + Intronic
1093365497 12:18291701-18291723 TTAATGGATCATTATGTGCCAGG - Intronic
1095909698 12:47413871-47413893 CTTATTAAGCACTATGTACCAGG + Intergenic
1095943894 12:47743131-47743153 CTTATGTATCACTATGTGCCGGG + Intronic
1096136494 12:49206452-49206474 TAAAGTTATGACTATGTGCCAGG + Intronic
1096522179 12:52190711-52190733 TTAATTGCTTACTATGTGCCAGG - Intronic
1096684570 12:53279507-53279529 CTGAGTTCTTACTATGTGCCAGG - Intronic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098000897 12:65941514-65941536 CTAATTTAGCACTATTTTCTTGG - Intronic
1101599317 12:106195205-106195227 CTGAGTTACCACCATGTGCCTGG + Intergenic
1101993638 12:109508419-109508441 TTAATTTCCCACTCTGTGCCAGG - Intronic
1102195629 12:111023326-111023348 ATAATTAATCACTATGTGCTAGG - Intergenic
1103394703 12:120598699-120598721 AGCATTTATCACTGTGTGCCAGG - Intergenic
1106457349 13:29938679-29938701 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1107179661 13:37444112-37444134 CAAATTTACCACTATGGACCAGG - Intergenic
1108139936 13:47409818-47409840 CTAAGTGTACACTATGTGCCAGG + Intergenic
1108221639 13:48240162-48240184 CTAATTTTTAACTCTGTTCCAGG - Intronic
1108313369 13:49216949-49216971 TTAAATTCTCACTTTGTGCCAGG + Intergenic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1110499916 13:76215035-76215057 CTTATTTATTGATATGTGCCAGG + Intergenic
1111914726 13:94349029-94349051 TCCATTCATCACTATGTGCCTGG - Intronic
1112358818 13:98697846-98697868 AGAATTTTTCACTGTGTGCCAGG - Intronic
1112990666 13:105509629-105509651 ATGATCTATTACTATGTGCCAGG - Intergenic
1114392137 14:22321102-22321124 CTTATGTAACACTACGTGCCAGG - Intergenic
1115539337 14:34404323-34404345 CTAATTTTTCTATATGTCCCAGG - Intronic
1116999162 14:51354758-51354780 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1119362564 14:74063478-74063500 CTGAATTATCACTATTGGCCAGG - Intronic
1119385160 14:74253524-74253546 TTCAGTTATCACTATGTGGCAGG + Intronic
1119522233 14:75294616-75294638 CGATTTTCTCACTCTGTGCCCGG + Intergenic
1119709308 14:76809814-76809836 CAAAGTATTCACTATGTGCCAGG + Intronic
1119921075 14:78446540-78446562 CTAAGTTCTTACTTTGTGCCAGG - Intronic
1120048903 14:79842119-79842141 CTGAGTTATTACTATGTGCCTGG + Intronic
1121065803 14:90963647-90963669 CTCATGGATCACTATCTGCCAGG + Intronic
1121477947 14:94229702-94229724 CTATTTTATGACTAAGTTCCAGG + Intronic
1124215099 15:27800010-27800032 CTAATTTAACTCCATGTGGCTGG - Intronic
1124436765 15:29656604-29656626 ATAATTTACCATTATTTGCCAGG + Intergenic
1126366611 15:47901204-47901226 CCATTTTAATACTATGTGCCAGG + Intergenic
1127107549 15:55632884-55632906 CTGAGTGATGACTATGTGCCAGG - Intronic
1128548251 15:68581493-68581515 CTAATTTAGGACTAGGGGCCAGG - Intronic
1128595144 15:68938900-68938922 TTGAATGATCACTATGTGCCAGG - Intronic
1130188248 15:81706876-81706898 CAAAGTCATCACTATGTGGCTGG - Intergenic
1133508481 16:6434860-6434882 CTGAGTTATTACTATGTGCTAGG + Intronic
1134074586 16:11281613-11281635 CTTGTTTATCACTATATACCAGG - Intronic
1134504548 16:14794395-14794417 TTAATCTTTCATTATGTGCCAGG - Intronic
1134576023 16:15334514-15334536 TTAATCTTTCATTATGTGCCAGG + Intergenic
1134812060 16:17176184-17176206 CTGAGCTCTCACTATGTGCCAGG + Intronic
1134836060 16:17361881-17361903 TTAAGTTCTCACTATGTTCCAGG + Intronic
1137397403 16:48125840-48125862 CTATTTTATCCCAAGGTGCCTGG - Intronic
1138015620 16:53425748-53425770 CTAATTTAGGAGTATGTGCCTGG - Intergenic
1138966672 16:62092999-62093021 CTTATTAATCACTATGTGCCAGG - Intergenic
1142922852 17:3206449-3206471 CTAAGTGCTAACTATGTGCCAGG + Intergenic
1143750941 17:9027196-9027218 CTCATCTATAGCTATGTGCCAGG - Intronic
1144482591 17:15639979-15640001 GTAAGTTCTTACTATGTGCCAGG + Intronic
1144916095 17:18725052-18725074 GTAAGTTCTTACTATGTGCCAGG - Intronic
1146097835 17:29949465-29949487 TTAATTTCTCACTGCGTGCCAGG - Intronic
1148206284 17:45782355-45782377 TTAAGCTCTCACTATGTGCCAGG + Intergenic
1150410975 17:64940316-64940338 CCACTTCATCACTATGTGACCGG + Intergenic
1150517744 17:65831636-65831658 CAAATTTCTCACTTTGTTCCTGG - Intronic
1150966119 17:69970847-69970869 TTAATTAATTACTAAGTGCCAGG - Intergenic
1151434138 17:74083658-74083680 CTAAATGCTCACCATGTGCCAGG - Intergenic
1154052088 18:10970582-10970604 ATAATTTCCCACTATGTTCCAGG - Intronic
1154269016 18:12903213-12903235 GTAATATATGACTATGTTCCTGG + Intronic
1154934043 18:21032815-21032837 CTAATTTGTCACTGTAGGCCGGG - Intronic
1156171928 18:34495051-34495073 TTATTTTATCTCTCTGTGCCCGG - Intronic
1158118476 18:54023227-54023249 CTAATTTAAGACTATGTGCTGGG - Intergenic
1159203177 18:65215386-65215408 CTAATTTGTTACAATGTGCTAGG + Intergenic
1160395732 18:78571352-78571374 CTAAATGTTCACTATGAGCCTGG - Intergenic
1166175358 19:41064707-41064729 TTAATTTGTCACTTTGTGCCAGG + Intergenic
1167029710 19:46949809-46949831 CCGAATGATCACTATGTGCCAGG - Intronic
1167582806 19:50356435-50356457 TTTATTATTCACTATGTGCCAGG - Intronic
1168435278 19:56311916-56311938 TTAATTGAGAACTATGTGCCAGG - Intronic
925581046 2:5411130-5411152 CTCATTTATAACTCTCTGCCTGG - Intergenic
927687739 2:25183750-25183772 CAAATCTCTGACTATGTGCCAGG + Intergenic
927831522 2:26355111-26355133 CTTATACAGCACTATGTGCCAGG - Intronic
927879908 2:26682971-26682993 CTAAGCTCTCACTATGTGCCAGG + Intergenic
928748683 2:34445952-34445974 CTGGATTATCACTATGTTCCAGG + Intergenic
929446671 2:42007616-42007638 CTGATTTGTCACTATGGGACTGG - Intergenic
935366217 2:102293628-102293650 CTAATTTATCAATATTTACCTGG - Intergenic
935441080 2:103096019-103096041 ATAATTTTTCACTGTTTGCCAGG - Intergenic
935811953 2:106807182-106807204 TTAATTTATCACTGTGGGCCTGG + Intronic
936889089 2:117348533-117348555 CTATTTTTTCATTATGTTCCTGG + Intergenic
936998592 2:118440598-118440620 TTAAGTTCTCACTATGTGCGAGG - Intergenic
937194820 2:120144021-120144043 CTAAATGCTCATTATGTGCCAGG - Intronic
937593366 2:123642366-123642388 CTGAGCTATCACTGTGTGCCAGG - Intergenic
937607667 2:123820962-123820984 CCAAATATTCACTATGTGCCAGG + Intergenic
940859777 2:158759732-158759754 CTATTTTAGCTTTATGTGCCAGG + Intergenic
941297273 2:163755543-163755565 TTGATTGATCACAATGTGCCAGG - Intergenic
941737194 2:168991552-168991574 CTTATTTATTAATCTGTGCCAGG - Intronic
942398722 2:175578894-175578916 CTAACTGACCACTAAGTGCCAGG + Intergenic
943144982 2:184031957-184031979 CAATTTTGTCACTATGTGGCAGG - Intergenic
944003531 2:194873360-194873382 CTAAATTGGCACTATGTTCCTGG - Intergenic
947083343 2:226422959-226422981 CTTAGTGATCACTATGTGCCAGG - Intergenic
1172012574 20:31854411-31854433 ATAAATTACCACTGTGTGCCAGG - Intronic
1172803190 20:37592572-37592594 CTGAATGCTCACTATGTGCCAGG - Intergenic
1174715736 20:52756361-52756383 CTAAGTTTCTACTATGTGCCTGG + Intergenic
1175613640 20:60373654-60373676 CCACTTTATAACTATGTGCCAGG - Intergenic
1177254889 21:18648815-18648837 CTATTTTTTTATTATGTGCCAGG + Intergenic
1177912966 21:27054551-27054573 CTAATTAATCACAGTGTTCCTGG + Intergenic
1178718966 21:34991500-34991522 CATAGCTATCACTATGTGCCCGG + Intronic
949536323 3:4998817-4998839 CTGAGTGGTCACTATGTGCCAGG + Intergenic
949821216 3:8117296-8117318 CTTATTTGTCATTCTGTGCCTGG + Intergenic
950797198 3:15519902-15519924 TTTATTGATTACTATGTGCCAGG + Intronic
952665371 3:35897728-35897750 CTAAACTCTCACTATGTGTCAGG + Intergenic
953789410 3:45935840-45935862 ATTAATTATCACAATGTGCCAGG - Intronic
955704080 3:61710321-61710343 TTGATATTTCACTATGTGCCAGG + Intronic
960016722 3:112898859-112898881 CTAATTTAACACTGTGTTGCAGG + Intergenic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
966005383 3:175005112-175005134 CTATGTTTTCACTATATGCCCGG + Intronic
966219189 3:177533755-177533777 CTGACTATTCACTATGTGCCAGG + Intergenic
966297264 3:178438899-178438921 TTAATTTCCTACTATGTGCCAGG + Intronic
966566011 3:181382343-181382365 ATAATTACACACTATGTGCCAGG + Intergenic
967250371 3:187531454-187531476 CTAAGTGATCAATATGTGCCAGG + Intergenic
967456933 3:189699023-189699045 CCATCTCATCACTATGTGCCTGG - Intronic
969555778 4:7908622-7908644 CTAATTCATCACTAATTGCTGGG + Intronic
969829688 4:9784927-9784949 TTTATTAAGCACTATGTGCCAGG - Intronic
971316305 4:25571093-25571115 ATAAATGATCACTGTGTGCCAGG - Intergenic
972644805 4:40957140-40957162 CTGAGTGATTACTATGTGCCCGG - Intronic
972968802 4:44547059-44547081 TTTATTGAGCACTATGTGCCAGG + Intergenic
973332744 4:48925911-48925933 CTTATGTATTACTATGTGCCAGG - Intergenic
974881612 4:67765369-67765391 CTGATTCCTTACTATGTGCCAGG - Intergenic
976227168 4:82804470-82804492 CTAATTCCTTACTATGTGCCAGG - Intergenic
976385962 4:84458886-84458908 CTAAGAATTCACTATGTGCCAGG + Intergenic
976902292 4:90193288-90193310 TTTATTGAACACTATGTGCCAGG - Intronic
977004966 4:91555454-91555476 TTGATTGATTACTATGTGCCGGG - Intronic
978623351 4:110656504-110656526 TTGAGTTCTCACTATGTGCCAGG - Intergenic
980029543 4:127811287-127811309 CTGATTGATCACTATGGGGCAGG - Intronic
980120185 4:128720127-128720149 CTCATCCATCACTATGTTCCTGG + Intergenic
980235572 4:130100810-130100832 CTAATTTTTCACTATCTAGCAGG + Intergenic
980759062 4:137204197-137204219 TTAATTATTGACTATGTGCCAGG - Intergenic
980944617 4:139307110-139307132 GTGATTTGTCACTATTTGCCAGG + Intronic
981009718 4:139913049-139913071 CTACATTATCACTGTGTGTCAGG - Intronic
981623348 4:146729006-146729028 ATAATATATCCCTATGTGCCTGG - Intronic
981656578 4:147118625-147118647 CTAAGTGACCACTATGTGCTAGG + Intergenic
984359515 4:178710719-178710741 CTGAGATATCACTATGTGCCAGG - Intergenic
984680820 4:182607278-182607300 CTAATTTATCTTTATGTGTTAGG + Intronic
986034545 5:3925238-3925260 TTTAATTGTCACTATGTGCCTGG + Intergenic
986859403 5:11908401-11908423 CTAATTGCTCCCTATTTGCCAGG - Intergenic
988969184 5:36448986-36449008 TTCATTTATCACTTTATGCCTGG + Intergenic
989491969 5:42067450-42067472 AAAATTTATCTTTATGTGCCTGG + Intergenic
989811296 5:45679327-45679349 CTAAGTTCTAACTAGGTGCCAGG - Intronic
990466112 5:56073302-56073324 CTGAGTGCTCACTATGTGCCAGG + Intergenic
991230193 5:64323731-64323753 ATAATTAATTACTATGTGCCAGG + Intronic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
992958615 5:81936713-81936735 TTTATTTATCACCCTGTGCCAGG + Intergenic
996096977 5:119409294-119409316 CTCATTTAGTACCATGTGCCTGG + Intergenic
996185909 5:120475070-120475092 TTAACTTCTCACTATGTGCCAGG + Intronic
996709613 5:126531244-126531266 CTAATTTCACACTATATGCCAGG + Intergenic
996908912 5:128633706-128633728 CTAATTAATCACAGTGTTCCTGG - Intronic
997435378 5:133870329-133870351 CTGAGTACTCACTATGTGCCAGG + Intergenic
997469950 5:134111998-134112020 CTGAGTGATTACTATGTGCCAGG - Intergenic
997856141 5:137374364-137374386 CCCATTTTTCACTATGTACCTGG - Intronic
999374833 5:151079668-151079690 CTAATAGCTTACTATGTGCCAGG - Intronic
1000200668 5:159007137-159007159 CTTATTTATAACTAATTGCCTGG - Intronic
1000491898 5:161924370-161924392 CTAGTTTCTTACTATGTGTCAGG + Intergenic
1001876118 5:175202650-175202672 GTAATTAATCACTGTGAGCCAGG + Intergenic
1002804240 6:557143-557165 TTAAGTTTTCACTTTGTGCCAGG + Intronic
1002959358 6:1899187-1899209 CTAATTATTTACCATGTGCCTGG - Intronic
1004381014 6:15132441-15132463 CTCATTAAACAGTATGTGCCAGG + Intergenic
1004529921 6:16444348-16444370 CTAGTATAACACTATGTTCCAGG - Intronic
1005251575 6:23951978-23952000 ATACATTATCACTATGTGCCAGG - Intergenic
1005972241 6:30770492-30770514 TTAATCAATTACTATGTGCCTGG + Intergenic
1009337475 6:62510187-62510209 ATTATTGATCACTATGTGCCAGG + Intergenic
1010325549 6:74558278-74558300 CTAATTAATCACAGTGTTCCTGG - Intergenic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1010643225 6:78356144-78356166 CTAAACCATCACTAAGTGCCAGG + Intergenic
1011207051 6:84911117-84911139 CTAGTTTACCACTATATGCCTGG + Intergenic
1011314083 6:86011829-86011851 CTAACTGATTCCTATGTGCCAGG - Intergenic
1011500154 6:87979351-87979373 ATAATTTGTCACTATTTTCCAGG - Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014147409 6:118014208-118014230 CTAAGTGTTCACTATGTGCTGGG - Intronic
1014989845 6:128061051-128061073 CTTATACATCACTATATGCCAGG - Intronic
1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG + Intergenic
1017088401 6:150736350-150736372 CTAATTGATTACTATGTGCCAGG - Intronic
1017586621 6:155932858-155932880 TTTATTTATTACTTTGTGCCTGG - Intergenic
1022798659 7:33753838-33753860 CTGACTTTCCACTATGTGCCTGG + Intergenic
1023006069 7:35868803-35868825 CTAATTTCTCAATATGTTCTAGG - Intronic
1023472726 7:40542139-40542161 GTTATTTAGCACTATGTGTCAGG + Intronic
1023523797 7:41077563-41077585 CTCAATTGTTACTATGTGCCAGG + Intergenic
1027060552 7:75082239-75082261 TTAATTTATCGCAATGAGCCTGG - Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027945540 7:84740701-84740723 CTCATTTATCTCTATGTACTTGG - Intergenic
1028874308 7:95803223-95803245 CTTATTGATCACTCAGTGCCAGG - Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1031415738 7:121494742-121494764 CTGAATGATTACTATGTGCCAGG + Intergenic
1032515945 7:132506282-132506304 ATAAAGTATAACTATGTGCCAGG - Intronic
1033244372 7:139705861-139705883 CTGAGTGCTCACTATGTGCCAGG + Intronic
1036572861 8:9997284-9997306 CTCATTTATCTCTATGTCCTCGG + Intergenic
1037089412 8:14895678-14895700 CTAAAATATTACTGTGTGCCAGG + Intronic
1041700043 8:60778516-60778538 CTAATTCATTACTGTGTGCTGGG + Intronic
1042341654 8:67685891-67685913 CTAATCTGTCACTATTTGACTGG + Intronic
1042970582 8:74404377-74404399 CTAGATGATTACTATGTGCCGGG + Intronic
1043992047 8:86767036-86767058 TTAATTTCTCACTATATCCCTGG + Intergenic
1044731984 8:95236409-95236431 TTAAGTAATTACTATGTGCCAGG + Intergenic
1047633649 8:126735527-126735549 CTGAGTTTTTACTATGTGCCAGG + Intergenic
1050149459 9:2604886-2604908 CTAAGTTCTTACTATGTGCCTGG + Intergenic
1051103037 9:13544587-13544609 GTGATTTATAACTATGAGCCTGG + Intergenic
1051193999 9:14543364-14543386 ATAAGATTTCACTATGTGCCAGG + Intergenic
1051381030 9:16458765-16458787 CTAAGCACTCACTATGTGCCGGG + Intronic
1051975882 9:22948002-22948024 CTTAATACTCACTATGTGCCAGG + Intergenic
1052976859 9:34417674-34417696 TTTATTTTTCACTGTGTGCCAGG + Intronic
1055017189 9:71631479-71631501 TTAAATTATCACTATGTGTCAGG - Intergenic
1055138941 9:72853345-72853367 ATTATTGAGCACTATGTGCCAGG - Intergenic
1056159992 9:83879575-83879597 CTTATCTAGTACTATGTGCCAGG - Intronic
1056360234 9:85850243-85850265 CTTATCTAGTACTATGTGCCAGG + Intergenic
1056695178 9:88842888-88842910 CAAACTTAGCACTGTGTGCCGGG - Intergenic
1058542688 9:106028430-106028452 CTGAATTATTATTATGTGCCAGG + Intergenic
1058759166 9:108113335-108113357 CTAATTGCTAACTATGGGCCGGG - Intergenic
1059070283 9:111128486-111128508 TTAATTGAGTACTATGTGCCAGG + Intergenic
1059580606 9:115544011-115544033 CTAAATTCTCACTATTTGCAGGG - Intergenic
1059928332 9:119235706-119235728 CTGATTTATGATTATATGCCTGG + Intronic
1061560920 9:131402597-131402619 CCCATTCATCACTGTGTGCCAGG + Intronic
1061735768 9:132656871-132656893 TTTATTTTTCTCTATGTGCCAGG + Intronic
1062589938 9:137269432-137269454 GTTATTTATAACTATGTTCCCGG - Intronic
1185673752 X:1832171-1832193 TTAATTTATCATTATGAGCTGGG - Intergenic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1189726653 X:43973992-43974014 CTATTTTATCACGATGTGTGTGG + Intergenic
1193958530 X:87894031-87894053 CTATTTTCTTACTATGTGCCAGG + Intergenic
1194279356 X:91929345-91929367 CTGAGTTCTTACTATGTGCCAGG + Intronic
1196426683 X:115576849-115576871 CTAATTATTAACAATGTGCCTGG + Intronic
1196969433 X:121092583-121092605 CTAAAGTATCACCAAGTGCCAGG - Intergenic
1197084413 X:122455186-122455208 CTAATTAATCATGATGTTCCTGG - Intergenic
1197409444 X:126097517-126097539 CTAATTAATCACTATGTTCCTGG - Intergenic
1199178299 X:144819309-144819331 CTACTTTATTACTATTTTCCTGG - Intergenic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic
1200596834 Y:5152839-5152861 CTGAGTTCTTACTATGTGCCAGG + Intronic