ID: 962500338

View in Genome Browser
Species Human (GRCh38)
Location 3:135984969-135984991
Sequence CCTGTTCTCGTGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 1, 1: 7, 2: 101, 3: 409, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962500338 Original CRISPR CCTGTTCTCGTGACAGTGAA TGG (reversed) Intronic
900903274 1:5531790-5531812 TCTGTTCTGGTGACATTGTAGGG + Intergenic
901464383 1:9411956-9411978 ACTGTTCTCGTGACGGTGAATGG + Intergenic
901750926 1:11407828-11407850 GCTGTTCTGGTGATAGTGAATGG + Intergenic
902611518 1:17600340-17600362 GCTGTTCTCTTGACAGTCTAAGG + Intronic
903101106 1:21030341-21030363 GCTGTTCTCTTGATAGTGAATGG + Intronic
903707448 1:25296672-25296694 GCTGTTCTTGTGACAGTGAGTGG + Intronic
903719791 1:25396682-25396704 GCTGTTCTTGTGACAGTGAGTGG - Intronic
904057253 1:27679612-27679634 GCTTTTCTTGTGATAGTGAATGG - Intergenic
904057587 1:27682030-27682052 GCTGGTCTCATGATAGTGAATGG - Intergenic
905492549 1:38355756-38355778 GCTGTTCTCAGGATAGTGAATGG + Intergenic
905496019 1:38387162-38387184 GCTGTTCTCATGATAGTGAATGG - Intergenic
905558782 1:38909321-38909343 CCTGTGCTCGTGATACGGAAGGG - Intronic
906187916 1:43875574-43875596 GCTGTTCTCATGATAGTGAATGG + Intronic
906763852 1:48408816-48408838 GCTGTTCTCATGATAGTGAATGG - Intronic
907347146 1:53791712-53791734 CCTGTTTTCTTGAAAGTGAAAGG - Intronic
908004212 1:59711748-59711770 GCTCTTCTCATGATAGTGAATGG - Intronic
908068466 1:60433389-60433411 GCTGTTCTCATGATAATGAATGG - Intergenic
908068746 1:60435318-60435340 GCTGTTCTCATGATAGTGAATGG - Intergenic
908387787 1:63659000-63659022 GCTGTTCTCATGATAGTGAATGG - Intronic
908667819 1:66511490-66511512 GCTTTTCTCCTGATAGTGAATGG + Intergenic
908989480 1:70069356-70069378 GCTGTTCTCATGATAGTGAGTGG - Intronic
909054356 1:70804691-70804713 GCTGTTCTTGTGATAGTGAATGG + Intergenic
909105317 1:71398853-71398875 GCTGTTCTTGTGATAGTGAATGG + Exonic
909153912 1:72045488-72045510 GCTGTTCTCCTGATAGTGAATGG + Intronic
909182920 1:72448575-72448597 GTTGTTCTCGTGATAGTGAATGG - Intergenic
909185509 1:72481162-72481184 ACTGTTCTTGTGATAGTGAATGG - Intergenic
909204521 1:72738426-72738448 GCTGTTCTCTTGAGAGTGAATGG - Intergenic
909257341 1:73439991-73440013 GCTGTTCTTGTGATAGTGAATGG + Intergenic
909317101 1:74236633-74236655 TCTGGTCTCTTGACATTGAAAGG + Intronic
909416748 1:75415275-75415297 GCTGTTCTCATGATAGTGAGTGG + Intronic
909439954 1:75686059-75686081 GCTGTTTTTGTGATAGTGAATGG - Intergenic
909469789 1:76014093-76014115 GCTGTTCTTGTGATAGTGAATGG - Intergenic
909602792 1:77478380-77478402 GCTGTTCTCATGATAGTGAATGG + Intronic
909953849 1:81753345-81753367 GCTATTCTCATGATAGTGAATGG - Intronic
910142123 1:84037800-84037822 CCTGTTCTGGTGGAAGTGACAGG + Intergenic
910255980 1:85248186-85248208 GCTGTTCTCATGCTAGTGAATGG - Intergenic
910309227 1:85804674-85804696 GCTGTTCTCGTGATAGTGAATGG - Intronic
910481502 1:87663110-87663132 GCTGTTCTCATGATAGTGAGTGG + Intergenic
910512758 1:88025003-88025025 GCTGTTCTCATGATAGTGAATGG - Intergenic
910513034 1:88026943-88026965 GCTGTTCTCATGGTAGTGAATGG - Intergenic
910606987 1:89097794-89097816 GCTGTTCTTGTGACAGTAAATGG + Intergenic
911134822 1:94428603-94428625 GCTGTTCTCGTGATAGTGAACGG + Intronic
911418705 1:97611264-97611286 GTTGTTCTCGTGATAGTAAATGG - Intronic
911686399 1:100781806-100781828 GCTGTTCTCGTGATAGTGAATGG - Intergenic
911840625 1:102676705-102676727 CCTTTTCTCATGACAGTGAATGG - Intergenic
911951785 1:104182420-104182442 TCTGTTTGCATGACAGTGAATGG + Intergenic
912138950 1:106697558-106697580 GCCATTCTCGTGATAGTGAATGG + Intergenic
912609335 1:111027643-111027665 GCTGTTCTCCTGATAGTGAATGG + Intergenic
913086204 1:115439332-115439354 GCTGCTCTTGTGATAGTGAATGG + Intergenic
915804472 1:158829967-158829989 GCTGTTCTCATGATAGTAAATGG - Intergenic
916864849 1:168845457-168845479 CTTATTCTCTTGAAAGTGAAAGG - Intergenic
916959076 1:169871303-169871325 CCTGTTCTCATGATAGTGAATGG + Intronic
917023589 1:170616108-170616130 GCTGTTCTCACGATAGTGAATGG + Intergenic
917753182 1:178073226-178073248 GCTGTTCTTGTGGTAGTGAATGG - Intergenic
917835703 1:178939811-178939833 CCTGTTGTGGTGACTCTGAATGG + Intergenic
918028018 1:180772643-180772665 GCTCTTCTCATGATAGTGAATGG + Intronic
918079354 1:181193774-181193796 GCTGTTCTTGTGATAGTGAATGG + Intergenic
918079626 1:181195710-181195732 GCTGTTCTTGTGATAGTGAATGG + Intergenic
918727898 1:187948505-187948527 GCTGTTCTCATGATAGTGAATGG + Intergenic
919449666 1:197755842-197755864 GCTGTTCTTGTGATAGTAAATGG - Intronic
919536871 1:198798111-198798133 GCTGTTCTCGTGATAGTGAGGGG - Intergenic
921594507 1:217039545-217039567 GCTGTTCTTGTGATAGTGAGTGG - Intronic
921758199 1:218883114-218883136 GCTGTTCTCATGATAGTGAGGGG - Intergenic
922115201 1:222606890-222606912 GCTGTTCTCATGATAGTGAATGG - Intergenic
922145564 1:222940368-222940390 GCTGTTCTCATGATAGTGAGTGG - Intronic
923259379 1:232252753-232252775 GCTGTTCTCGTGATAGTGAATGG + Intergenic
923977912 1:239285578-239285600 GCTGTTCTTGTGATAATGAATGG - Intergenic
924062437 1:240188955-240188977 GCTCTTCTCATGATAGTGAATGG - Intronic
1063550761 10:7030743-7030765 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1064436700 10:15317101-15317123 CCTGTTTCCGTGACTGGGAAAGG - Intronic
1066636715 10:37510465-37510487 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1066636948 10:37512419-37512441 GCTGTTCTCATAATAGTGAATGG + Intergenic
1068055808 10:52011843-52011865 GCTGTTCTCGTGATAGTGAATGG + Intronic
1068110587 10:52675562-52675584 GCTGTTCTTGTGATAGTGAGAGG + Intergenic
1068264145 10:54625494-54625516 GCTGTTCTCATGATGGTGAATGG + Intronic
1068264402 10:54627405-54627427 ACTGTTCTCATGATAGTGAATGG + Intronic
1068305768 10:55205979-55206001 GCTGTTCTCGTGATAGTGAATGG - Intronic
1068559396 10:58496403-58496425 GCTTTTCTTGTGATAGTGAATGG + Intergenic
1068747619 10:60552853-60552875 GCTGTTCTTGTGATAGTGAATGG + Intronic
1069155998 10:65031953-65031975 GCTGTTCTTGTGATACTGAATGG - Intergenic
1069156822 10:65039741-65039763 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1069540052 10:69287322-69287344 GCTGTTCTTGTGATAGTGAGTGG - Intronic
1069549690 10:69354498-69354520 GCTGTTCTCGTGATAGTGAGTGG - Intronic
1070375840 10:75830601-75830623 ATTGTTCTCATGATAGTGAATGG - Intronic
1070376149 10:75832843-75832865 GTTGTTCTCGTGATAGTGAATGG - Intronic
1071018683 10:81027686-81027708 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1071018817 10:81028779-81028801 GCTAGTCTCGTGATAGTGAATGG - Intergenic
1071557842 10:86619660-86619682 TCTATTCTCATGATAGTGAATGG - Intergenic
1072144334 10:92620800-92620822 GCTGTTCTCATTACAGGGAATGG - Intronic
1072307134 10:94118530-94118552 GCTGTTCTCATGATAGTGAATGG + Intronic
1072852785 10:98914158-98914180 GCTGTTCTTGTGATAGTGAATGG + Intronic
1073260295 10:102184730-102184752 GCTGTTCTGGTGATAGTGAATGG - Intergenic
1073730601 10:106283054-106283076 GCTGTTCTCATGATAGTGAATGG - Intergenic
1073833242 10:107411068-107411090 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1074207917 10:111300539-111300561 GCTGTTCTCATGGTAGTGAATGG + Intergenic
1074969647 10:118525567-118525589 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1075354412 10:121757679-121757701 ACTGTTTTTGTGATAGTGAATGG - Intronic
1075571107 10:123546406-123546428 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1075826020 10:125357624-125357646 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1076225560 10:128772135-128772157 GCTGTCCTTGTGATAGTGAATGG + Intergenic
1077797265 11:5505703-5505725 GCTGTTCTCGTGACAGTGAATGG - Intronic
1077932677 11:6750859-6750881 GCTGTTCTAGTGAGAGTGAATGG + Intergenic
1078117538 11:8468240-8468262 CATGTTCTCATGATAGTGACTGG - Intronic
1078442997 11:11383049-11383071 CCTGATCTCCTGACATTGGAGGG + Intronic
1079272761 11:19004088-19004110 GCTGTTCTTGTTACAGTGAATGG + Intergenic
1079298326 11:19254714-19254736 GCTGTTCTCATGATAGTGAATGG - Intergenic
1079694266 11:23459510-23459532 GCTATTCTCTTGATAGTGAATGG - Intergenic
1079838373 11:25364478-25364500 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1080087519 11:28302491-28302513 GCTGTTCTCATGATAATGAATGG + Intronic
1080088380 11:28314806-28314828 GCTGTTCTCCTGATAGTGAATGG + Intronic
1080415477 11:32066039-32066061 TCTGCTCCCGTCACAGTGAATGG + Intronic
1080796721 11:35571025-35571047 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1081019639 11:37929582-37929604 ACAATTCTCTTGACAGTGAAAGG + Intergenic
1081120741 11:39262687-39262709 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1081239041 11:40680542-40680564 GCTGTTCTCGTGATACTGAAAGG + Intronic
1081507768 11:43735929-43735951 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1081635005 11:44715277-44715299 GCTGTTCTTATGACAGTGAGTGG - Intergenic
1083120252 11:60505279-60505301 GCTGTTCTTGTGACAGTGAATGG - Intronic
1084485026 11:69443236-69443258 CAAGGTCTTGTGACAGTGAAAGG - Intergenic
1084880542 11:72168327-72168349 GCTGTTCTCATGATAATGAATGG + Intergenic
1084880868 11:72170585-72170607 CATGTTCTTGTGAGAGTGAATGG + Intergenic
1085941959 11:81215210-81215232 GCTATTCTCCTGATAGTGAATGG - Intergenic
1086764444 11:90676717-90676739 GCTGTTCTCATGATAGTGATTGG + Intergenic
1086844659 11:91733615-91733637 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1086850218 11:91799648-91799670 ACTATTCTCGTGATAGTGAATGG - Intergenic
1086851593 11:91815535-91815557 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
1087226490 11:95606599-95606621 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1087255415 11:95947854-95947876 GCTATTCTCATGATAGTGAATGG - Intergenic
1087255684 11:95949818-95949840 GCTGTTCTTGTGATTGTGAATGG - Intergenic
1087325324 11:96714741-96714763 GCTGTTCTCATGATATTGAATGG - Intergenic
1087497464 11:98908904-98908926 GCTGTTCTCATGATACTGAATGG + Intergenic
1087516699 11:99173084-99173106 GCTGTTCTCATGACAGTGAGTGG - Intronic
1087838223 11:102895998-102896020 GCTGTTCTCATGATAGTGAATGG + Intergenic
1087864246 11:103204171-103204193 GCTATTCTCATGATAGTGAATGG - Intronic
1087924182 11:103900343-103900365 GCTGTTCTAGTGATAGTTAATGG + Intergenic
1088206152 11:107395165-107395187 GCTGTTCTCGTGATAGTGAATGG + Intronic
1088524840 11:110741260-110741282 GCTGCTCTCATGATAGTGAATGG + Intergenic
1088531228 11:110811926-110811948 ACTGTTCTCATGATAGTGAATGG - Intergenic
1088668350 11:112117375-112117397 GCTGTTCTCATGATAGTGAATGG - Intronic
1089584296 11:119500431-119500453 GCTGTTCTCATGATAGTGAACGG + Intergenic
1090638796 11:128712671-128712693 GCTGTTCTCATGATAGTGAATGG - Intronic
1090864020 11:130679805-130679827 GCTGTTTTCATGAGAGTGAATGG - Intronic
1093193702 12:16105334-16105356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1093352972 12:18127135-18127157 GCTGTTCTAGTGACAGTGAATGG + Intronic
1093890335 12:24512384-24512406 TCTGTTCTGGTGACAATGGAAGG - Intergenic
1093974075 12:25401645-25401667 GCTGTTCTCTTAATAGTGAATGG + Intergenic
1094182320 12:27604975-27604997 GCTGTTCTTGTGATAGTGAATGG - Intronic
1094417080 12:30228497-30228519 GCTGTTTTCATGATAGTGAATGG + Intergenic
1094539453 12:31351074-31351096 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1094599028 12:31892261-31892283 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1094759419 12:33513397-33513419 GCTGTTCTCCTGATAGTAAATGG + Intergenic
1095324351 12:40870004-40870026 GCTGTTCTCATGATAGTGAGTGG + Intronic
1095394844 12:41750282-41750304 GCTGTTCCTGTGATAGTGAACGG - Intergenic
1095641012 12:44484717-44484739 GTTGTTCTCGTGATAGTGAGTGG - Intergenic
1095731700 12:45512743-45512765 GCTGTTCTCATGATAGTGAGGGG - Intergenic
1095796327 12:46222914-46222936 GCTGTTTTCATGACAGTAAAGGG + Intronic
1095928676 12:47605033-47605055 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1097343510 12:58466356-58466378 AGTGTTCTCGTGATAGTGAGTGG - Intergenic
1097429450 12:59486537-59486559 GCTGTTCTCCTGACAGTGGTTGG + Intergenic
1097565773 12:61266200-61266222 GCTGTTCTTGTGATAGTAAATGG + Intergenic
1098201220 12:68058032-68058054 GCTGTTCTCATGATAGTGAATGG - Intergenic
1098489418 12:71058312-71058334 GCTGTTCCCATGATAGTGAATGG + Intronic
1098743296 12:74201656-74201678 GCTGTTCTTATGACAGTGAATGG - Intergenic
1098768480 12:74520813-74520835 GCTCTTCTCATGATAGTGAATGG - Intergenic
1098792224 12:74837816-74837838 GCTGTTCTTGGGATAGTGAATGG + Intergenic
1098836917 12:75434578-75434600 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1099374809 12:81886171-81886193 GCCATTCTCGTGATAGTGAATGG + Intergenic
1099452425 12:82823725-82823747 CCTGTTCTTGAGAAAGGGAATGG + Intronic
1099840160 12:87954830-87954852 GCTGCTCTCATGATAGTGAATGG + Intergenic
1099937700 12:89147530-89147552 GCTGTTCTTATGATAGTGAATGG + Intergenic
1099990864 12:89719419-89719441 ACTGTTGTTGTGATAGTGAATGG + Intergenic
1099996838 12:89787425-89787447 GCTGTTCTTGTGATATTGAATGG + Intergenic
1100072353 12:90736124-90736146 GCTGTTCTCATGACAGTGAGTGG - Intergenic
1100811704 12:98345184-98345206 GCTATTCTCTTGATAGTGAAAGG - Intergenic
1101005677 12:100398823-100398845 GCTTTTCTCGTGGTAGTGAATGG + Intronic
1101464729 12:104936625-104936647 GCTGTTCTCATGATAGTGAATGG - Intronic
1101766007 12:107700065-107700087 GCTGTTCTCATGATAGTGAATGG - Intronic
1104025625 12:125024266-125024288 GCTGTTCTTGTGACAGTGGAGGG - Intronic
1105484449 13:20813131-20813153 GCTGTTCTCGTGACATTGTGTGG - Intronic
1105609574 13:21956236-21956258 GCTGTTCTGGTGATAGTGAATGG - Intergenic
1106152151 13:27115313-27115335 CCTGTTCTGGAGAGAGAGAAAGG + Intronic
1106877424 13:34088996-34089018 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1107101997 13:36603252-36603274 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1107263508 13:38523627-38523649 CTTGTTCCCATGACAGTGCAAGG - Intergenic
1107282266 13:38750289-38750311 GCTGTTCTTGTGATAATGAATGG + Intronic
1107541917 13:41396748-41396770 GCTGTTCTCATGATAATGAATGG - Intergenic
1107554622 13:41507174-41507196 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1107863159 13:44680302-44680324 GCTGTTCTCATGATAGTGAATGG + Intergenic
1108103142 13:46979277-46979299 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1108142371 13:47437253-47437275 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1108719514 13:53117032-53117054 GCTGTTCTCATAATAGTGAATGG - Intergenic
1108757551 13:53522249-53522271 CCTGTGGTTGTGAAAGTGAAAGG + Intergenic
1109285598 13:60404907-60404929 GCTGTTCTCGTGATAGTGAATGG + Intronic
1109314986 13:60739889-60739911 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1109393414 13:61722903-61722925 GCTGTTCTCGTGTTAGTGAATGG + Intergenic
1109764841 13:66881439-66881461 GCTGTTCTCTTGATAATGAATGG - Intronic
1109766477 13:66906619-66906641 CCTGTTTTTGGAACAGTGAATGG + Intronic
1109811356 13:67517085-67517107 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1109906068 13:68844261-68844283 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110377725 13:74813440-74813462 ACTGTTCTCATGATAGTGAATGG + Intergenic
1110377981 13:74815275-74815297 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110649273 13:77924791-77924813 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111029246 13:82574517-82574539 GCTGTTCTCATGATAGTGAATGG - Intergenic
1111629901 13:90837058-90837080 GGTGTTCTTATGACAGTGAATGG - Intergenic
1111686471 13:91507530-91507552 GCTGTTCTTGTGATAGTGAATGG - Intronic
1111841660 13:93456963-93456985 CCTGTTCTCATGATAGTAAGTGG + Intronic
1111956699 13:94766802-94766824 GCTGTTCTGGTGACAGTGAGTGG - Intergenic
1112071268 13:95853032-95853054 CCTGTTCTCTTGACAGTGAGTGG + Intronic
1112159554 13:96853470-96853492 GCTATTCTCATGATAGTGAATGG + Intergenic
1112874976 13:104026033-104026055 GCTGTTCTTGTGATAGTAAATGG + Intergenic
1113068478 13:106394951-106394973 GCTGTGCTCGTGATAGTAAATGG - Intergenic
1113285079 13:108837152-108837174 GCTGTTCTCATGATAGTGAGTGG + Intronic
1114320831 14:21546000-21546022 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1114589104 14:23843310-23843332 GCTGTTTTCCTGGCAGTGAAGGG + Intergenic
1114680342 14:24479094-24479116 GCTGTTCTTGTGAAAGTGAGTGG - Intergenic
1114984407 14:28209283-28209305 GCTGTTCTCATGATAGTGAATGG + Intergenic
1115002437 14:28439207-28439229 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1115112503 14:29840800-29840822 GCTGTTCTCGTCATAGTGAGTGG - Intronic
1115404297 14:32997530-32997552 GCTGTTCTTGGGATAGTGAATGG + Intronic
1115773391 14:36689242-36689264 GCTGTTCTCGTGATAGTGAATGG - Intronic
1115840163 14:37461368-37461390 GCTGTTCTTATGATAGTGAATGG - Intronic
1115968348 14:38916929-38916951 ACTGTTCTCATGATAGTGATGGG - Intergenic
1116095163 14:40358626-40358648 GCTGTTCCTGTGATAGTGAATGG + Intergenic
1116368586 14:44101925-44101947 CATGTCCTCCTGAGAGTGAATGG - Intergenic
1116387271 14:44347261-44347283 GCTATTCTTGTGATAGTGAATGG + Intergenic
1116618045 14:47163440-47163462 GCTGTTCTGGTGATAGTGAATGG + Intronic
1116642603 14:47484737-47484759 GCTGTTCTCCTAATAGTGAATGG + Intronic
1116761964 14:49026009-49026031 GCTGTTCTCATGATAGTGAATGG + Intergenic
1116762229 14:49027939-49027961 GCTGTTCTCATGATAGTGAATGG + Intergenic
1117004233 14:51402413-51402435 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1117054295 14:51895818-51895840 GCTGTTCTTGCGATAGTGAATGG + Intronic
1117313156 14:54548453-54548475 ACTTTTCTCCTGACAGTAAATGG - Intergenic
1117977604 14:61313791-61313813 GCTGTTCTCATGACAGTGAGTGG - Intronic
1118069482 14:62230774-62230796 GCTGTTCTCATGATAGTGAATGG + Intergenic
1118069740 14:62232695-62232717 GCTTTTCTCGTGTTAGTGAATGG + Intergenic
1118071030 14:62246600-62246622 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1118597837 14:67449754-67449776 GCTGTTCTTGTGATAGTGAATGG + Intronic
1118598149 14:67451988-67452010 GCTGTTCTCATGATAGAGAATGG + Intronic
1118863816 14:69686723-69686745 GCTGTTCTCATGATAGTGAATGG - Intronic
1119200422 14:72747765-72747787 GCTGTTCTTATGATAGTGAATGG + Intronic
1120248055 14:82028830-82028852 GCTGTTCTCATGATAGTGAATGG - Intergenic
1120606243 14:86582282-86582304 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1120621800 14:86774233-86774255 GCTGCTCTCGTGATACTGAATGG + Intergenic
1120622077 14:86776242-86776264 GCTGCTCTCATGATAGTGAATGG + Intergenic
1120712620 14:87808360-87808382 GCTGTTCTCATGAAAGTGAATGG + Intergenic
1120742022 14:88118877-88118899 GCTGATCTCGTGATAGTGAATGG - Intergenic
1121203025 14:92135963-92135985 GCTGTTCTTGTGATAGTGAATGG + Intronic
1121464239 14:94103902-94103924 CTTGTTCTCATGGCAGTGATGGG - Intergenic
1121508990 14:94498342-94498364 GCTGTTCTCCTCACGGTGAAAGG - Exonic
1121536304 14:94693353-94693375 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1121874312 14:97437385-97437407 GCTGTTCTTGCGACAGTGAATGG + Intergenic
1121937344 14:98032060-98032082 GCTGTTCTCATGATAGTGAATGG + Intergenic
1121991201 14:98559485-98559507 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1122344570 14:101050513-101050535 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1123796284 15:23774339-23774361 CCTGTTGTCATGATAGTGAATGG + Intergenic
1124693948 15:31847931-31847953 GCTGTTCTCATGATAGTGAGTGG - Intronic
1125125411 15:36214471-36214493 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1126411618 15:48377817-48377839 GCTGTTTTCATGATAGTGAATGG + Intergenic
1126829167 15:52582234-52582256 CCTGTTCTCTAGAAAGTCAATGG - Exonic
1127009545 15:54607797-54607819 GCCTTTCTTGTGACAGTGAATGG - Intronic
1127123838 15:55793431-55793453 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1127129072 15:55843024-55843046 ACTGTTCTCATGATAGTGAATGG + Intronic
1128417970 15:67464578-67464600 CATTTTCTCATGAGAGTGAAGGG - Intronic
1128429040 15:67573454-67573476 GCTGTTCTCATGATAGTGAGTGG - Intronic
1128535712 15:68488770-68488792 GCTGTTCTTGTGACAGTGAATGG - Intergenic
1128613598 15:69092650-69092672 CCTGATCTGGTGACAGTTATAGG + Intergenic
1128718491 15:69928053-69928075 GCTGTTCTCATGATAGTGAATGG - Intergenic
1128718751 15:69930001-69930023 GCTGTTCTCATTATAGTGAATGG - Intergenic
1128804899 15:70523393-70523415 GCTGTTCTCCTGATAGTGAGTGG - Intergenic
1130084080 15:80762727-80762749 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131005085 15:88971440-88971462 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131642085 15:94303601-94303623 GCTGTTCTCGTGACAGTGAATGG - Intronic
1131773346 15:95765315-95765337 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1131782938 15:95879814-95879836 CCTGTTACCGTGACACTGCACGG - Intergenic
1131914693 15:97251974-97251996 GCTGTTATCCTGATAGTGAACGG + Intergenic
1132166626 15:99598573-99598595 GCTGTTCTTGTGAGATTGAATGG + Intronic
1133648722 16:7788984-7789006 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1133851214 16:9505652-9505674 GCTGTTCTTGGGAGAGTGAATGG - Intergenic
1134105000 16:11478854-11478876 GCTGTTCGCGTGATAGTGAATGG + Intronic
1135152801 16:20024217-20024239 GCTGTTGTCATGATAGTGAATGG + Intergenic
1135166120 16:20140626-20140648 CCTGTTCTCGCGGCATTTAATGG + Intergenic
1136663019 16:31781562-31781584 GCTGTTTTTGTGATAGTGAATGG + Intronic
1138088596 16:54155852-54155874 GTTGTTCTCGTGATAGTGAGCGG - Intergenic
1140424534 16:74849700-74849722 GCTGTTCTCGTGACAGTGAGTGG + Intergenic
1140566299 16:76046832-76046854 ACTGTTCTCATGACAGTGAATGG - Intergenic
1142223605 16:88866783-88866805 CCTGTCCGAGTGACAGGGAAGGG - Intergenic
1143119010 17:4595854-4595876 CCAGTCCTCGTGTCAGTGCATGG + Intronic
1143931995 17:10438680-10438702 GCTGTTCTTGTGATAGTGAGTGG - Intergenic
1144352394 17:14409871-14409893 GCTGTTGTCATGATAGTGAATGG - Intergenic
1144440265 17:15274992-15275014 GCCGTTCTCATGATAGTGAATGG - Intergenic
1149214313 17:54336194-54336216 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1149233955 17:54569615-54569637 GCTATTCTTGTGATAGTGAATGG - Intergenic
1149369571 17:55979513-55979535 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1150687528 17:67332518-67332540 GCTATTCTCGTGATAGTGAATGG + Intergenic
1150892450 17:69168752-69168774 GCTGTTCTCATGATAGTGGATGG + Intronic
1151007833 17:70458666-70458688 GCTGTTCTCGTGATGGTGAATGG - Intergenic
1151045809 17:70918168-70918190 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1151339877 17:73464281-73464303 ACCGTTCTCGTGATAGTGAGTGG + Intronic
1151500857 17:74487875-74487897 GCTGTTCTTCTGATAGTGAATGG - Intergenic
1151501133 17:74489822-74489844 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1151504571 17:74518724-74518746 GCTGTTCTGGTGGTAGTGAATGG + Intergenic
1151930940 17:77230866-77230888 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1153379319 18:4419220-4419242 GCTGTTCTCATGATAGTAAATGG - Intronic
1154049632 18:10941936-10941958 GCTGTTCTCATGATAGTGAAGGG + Intronic
1154049894 18:10943860-10943882 GCTGTTCTCATGATAGTGAATGG + Intronic
1154064033 18:11089944-11089966 CCTCTTCTCCTTACAGAGAAGGG + Intronic
1155156173 18:23159456-23159478 CCTGTTTTCTTGAGAGAGAAAGG + Intronic
1155311813 18:24531612-24531634 GCTGTTCTCGTAATAGTGAGTGG + Intergenic
1155807383 18:30189109-30189131 GCTGTTCTCATGATAGTGAATGG - Intergenic
1155851586 18:30781552-30781574 ACTGTTCTCATGATAGTGAATGG + Intergenic
1156254437 18:35381718-35381740 GCTGTTCTCATGATAGTGAATGG - Intergenic
1156543312 18:37938661-37938683 GCTGTTTTGGTGATAGTGAATGG + Intergenic
1157130014 18:44998068-44998090 CCTGTTCTAGTTAAAGAGAAGGG + Intronic
1157607448 18:48934749-48934771 CATGTTCTCGTGGGAGTGGAAGG + Intronic
1158445229 18:57514207-57514229 GCTCTTCTTGTGACAGTGTATGG - Intergenic
1158483905 18:57847566-57847588 GCTGTTCTCATGATAGTGAATGG - Intergenic
1158739987 18:60130090-60130112 CCTGGTATAGTGACAGTGACAGG - Intergenic
1158768528 18:60485843-60485865 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1158860966 18:61592023-61592045 GCTGTTCTCTTGATGGTGAATGG + Intergenic
1158887558 18:61842838-61842860 GCTGTTCTTGTGATAGTGAATGG - Intronic
1158918631 18:62164557-62164579 GCTGTTCTCCTGATAGTGAGTGG - Intronic
1159237390 18:65694255-65694277 GCTGTTCTCATGATAGTGCATGG - Intergenic
1159345334 18:67195045-67195067 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1159641342 18:70865673-70865695 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1159650263 18:70970334-70970356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159718995 18:71861670-71861692 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159762927 18:72451246-72451268 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1159765360 18:72481749-72481771 GCTGTTCTCGTGATAGTAAATGG + Intergenic
1160126997 18:76184507-76184529 AATGTTCTCATGATAGTGAATGG + Intergenic
1160252616 18:77216604-77216626 GCTATTCTTGTGATAGTGAATGG + Intergenic
1160331240 18:77993774-77993796 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1163472034 19:17503113-17503135 GCTGTTCTCATGATAGTGAAGGG - Intronic
1164237700 19:23351480-23351502 TTTCTTCTCATGACAGTGAAAGG - Intronic
1164251590 19:23482159-23482181 TGTCTTCTCGTGACAGTGAAAGG - Intergenic
1164274789 19:23706766-23706788 GCTGTTCTCATGACAGTGAATGG + Intergenic
1164320309 19:24138329-24138351 TTTCTTCTCATGACAGTGAAAGG + Intergenic
1165280611 19:34794140-34794162 GCTGTCCTTGTGATAGTGAATGG - Intergenic
1166059838 19:40319453-40319475 CCTGTTCTCTAAACAGGGAAAGG + Intergenic
1166409838 19:42549181-42549203 GCTGTTCTTGTGATAGTGAGTGG + Intronic
1166623857 19:44331698-44331720 ACTGTTCACTTGGCAGTGAAAGG - Intronic
1167492551 19:49800971-49800993 CATGTTCTCGTGACAGGCAGGGG - Exonic
924991447 2:316071-316093 GCTGTTCTCATGGTAGTGAATGG + Intergenic
925250197 2:2427637-2427659 GCTGTTCTAGTGATAGTGAATGG - Intergenic
925482461 2:4291530-4291552 GCTGTTATTGTGACAGTGAGTGG + Intergenic
925737329 2:6975271-6975293 GCTGTTCTTGTGATAGTGAATGG - Intronic
926377778 2:12250892-12250914 GCTGTTCTCGTGACAGTGAATGG + Intergenic
926607873 2:14915523-14915545 GCTATTCTCATGACAGTGAATGG + Intergenic
926713904 2:15908634-15908656 GCTGTTCTCGTGATAGTGAACGG + Intergenic
927298108 2:21478141-21478163 GCTGTTCTCATGATAGTGAATGG - Intergenic
927400896 2:22708459-22708481 GCTGTTCTTGTGGTAGTGAATGG - Intergenic
927461598 2:23304111-23304133 GCTGTTCTCGTGATAGTGAAAGG - Intergenic
927693047 2:25221916-25221938 CCTCTTCTCTAGACAGTGGAGGG - Intergenic
928680542 2:33697718-33697740 GCTGTTCTCATGATAGTGAATGG + Intergenic
929040167 2:37736994-37737016 GCTGTTCTCGTGATTGTGAGTGG - Intronic
930263251 2:49171085-49171107 GCTGTTCTTATGATAGTGAATGG + Intergenic
930457367 2:51622490-51622512 GCTGTTCTCATGAGAGTGAATGG - Intergenic
930579594 2:53194566-53194588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
930602172 2:53455806-53455828 GCTGTTCTTGTGATAGCGAATGG - Intergenic
930925362 2:56811314-56811336 GCTGCTCTTATGACAGTGAATGG + Intergenic
931154566 2:59614097-59614119 GCTGTTCTTGTGATAGTGAATGG - Intergenic
932438746 2:71718466-71718488 CCTGTCCTGGTGACAGAGTATGG - Intergenic
932885083 2:75542045-75542067 GCTGTTCTCGTGATAGTGAATGG + Intronic
933038122 2:77426609-77426631 ACTGTTCTTGTGAGAGTGAGTGG + Intronic
933268001 2:80203051-80203073 GCTGTTCTCATGATAGTGAGTGG - Intronic
933852049 2:86375984-86376006 GCTGTTCTCATGATAGTGACTGG + Intergenic
934117943 2:88813487-88813509 GCTGTTCTTGTGATAGTGAATGG + Intergenic
934576962 2:95408626-95408648 GCTGTTCTCATGATAGTGAATGG - Intronic
934639215 2:96017024-96017046 GCTGTTCTCATGATAGTGAATGG - Intergenic
934711158 2:96515097-96515119 GCTGTTCTTGTGATAGTGAATGG - Intergenic
934794434 2:97088387-97088409 GCTGTTCTCATGATAGTGAATGG + Intronic
934950913 2:98574853-98574875 TCTGTTCTGGTGACAGGGGATGG - Intronic
935094170 2:99927946-99927968 GCTGTTCTCATGATAGTGCATGG + Intronic
935096754 2:99952185-99952207 GCTGTTCTTGTGACAGTGAGTGG + Intronic
935099770 2:99982266-99982288 GCCGTTCTCGTGATAGTGCATGG + Intronic
935498397 2:103808991-103809013 GCTGTTCTTGTGACAGTGGATGG + Intergenic
935923509 2:108041432-108041454 GCTGTTCTCATGATAGTGAATGG + Intergenic
936289663 2:111211774-111211796 GCTGTTCTCCTGACAGTGAATGG + Intergenic
936595759 2:113845896-113845918 GCTGTTCTTGTGACAGCGGATGG + Intergenic
936659126 2:114522890-114522912 GCTGTTCTCATGAGAGTGAATGG - Intronic
936800714 2:116261531-116261553 GCTGTTCTCATGATAGTGAAAGG + Intergenic
936993562 2:118390788-118390810 GTTGTTCTCGTGATAGTGAATGG + Intergenic
937498250 2:122449119-122449141 GCTGTTCTTGTGATAGTGAGTGG - Intergenic
937548364 2:123053522-123053544 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
939182174 2:138816363-138816385 GTTGTACTCGTGATAGTGAATGG + Intergenic
939190479 2:138911890-138911912 GCTGTTCTCATGATAGTGAATGG - Intergenic
939374759 2:141350091-141350113 GCTGCTCTTGTGACAGTGAGGGG - Intronic
939436556 2:142184556-142184578 GCTGTTCTCATGATAGTGAATGG - Intergenic
940024427 2:149190660-149190682 GCTGTTCTCATGACATTTAAGGG + Intronic
940543127 2:155046946-155046968 GCTGTTCTTGTGATAGTGAATGG - Intergenic
940552294 2:155175025-155175047 ATAGTTCTCGTGATAGTGAATGG - Intergenic
940554490 2:155206170-155206192 GCTGTTCTCATGATAATGAATGG - Intergenic
940686456 2:156857118-156857140 GCTGTTCTCATGAGAGTGTATGG - Intergenic
941123879 2:161562500-161562522 GCTGTTCTCATGATAGTGAATGG + Intronic
941140718 2:161777689-161777711 GCTGTTCTCGTGACAGTAAATGG - Intronic
941319769 2:164040593-164040615 GCTGCTCTTGTGATAGTGAATGG - Intergenic
941320034 2:164042445-164042467 GCTGTTCTCATGATAGTGAATGG - Intergenic
941952627 2:171172604-171172626 GCTGTTCTTGTGATAGTGAGTGG + Intronic
942068241 2:172291875-172291897 GCCGTTCTCATGACAGTGAGTGG + Intergenic
942127764 2:172844499-172844521 CCTCTCCTCCTTACAGTGAATGG + Intronic
942508498 2:176669999-176670021 CCTGCTCTCCTGAAAGTAAATGG - Intergenic
943123965 2:183773120-183773142 GCTGTTCTCCTGATAGTGAATGG + Intergenic
943176503 2:184481616-184481638 GCTGTTCTTTTGATAGTGAATGG + Intergenic
943277668 2:185888995-185889017 GCTATTCTCGTGATAATGAATGG - Intergenic
943447712 2:188009499-188009521 GCTGTTCTCGTGATAGTGAATGG - Intergenic
943478052 2:188384365-188384387 GCTGTTCTCATGATAGTGAGTGG - Intronic
943478317 2:188386289-188386311 GCTGTTCTCATGATAGTGAGTGG - Intronic
943878641 2:193108926-193108948 GCTGTTCTCGTGATAGTGAATGG + Intergenic
943959338 2:194241512-194241534 GCTGTTCTCATGATAGCGAATGG - Intergenic
943961605 2:194271530-194271552 CTTATACTCGTGACAGTGAGTGG - Intergenic
944026766 2:195179817-195179839 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
944371061 2:198984690-198984712 GCTGTTCTTGTGACACTGAGTGG - Intergenic
944721763 2:202429836-202429858 GCTGTTCTCATGACAGTGAGTGG - Intronic
944808732 2:203307646-203307668 GCTGTTCTCCTGATAGTGAATGG + Intergenic
944937819 2:204587836-204587858 GCTGTTTTTGTGATAGTGAATGG + Intronic
945073496 2:206014455-206014477 GTTGTTCTCGTAATAGTGAATGG + Intronic
945643953 2:212466469-212466491 GCTGTTCTTATGATAGTGAATGG + Intronic
945769362 2:214021486-214021508 GCTGCTCTCATGACAGTGAATGG - Intronic
946144077 2:217715501-217715523 CTTGTTCTCATGCCAGTGACAGG - Intronic
946439543 2:219683589-219683611 GCTGTTCTTGTGATAGTGAATGG + Intergenic
946673027 2:222126859-222126881 GCTGTTCTCATGATAGTGAATGG - Intergenic
946882846 2:224193646-224193668 GCTGTTCTCATGATGGTGAATGG - Intergenic
947021096 2:225676643-225676665 GCTGTTCTCGTGATAGTGAATGG - Intergenic
947243931 2:228026013-228026035 ACTGTTCTTGTGATAGTGAGTGG + Intronic
947248277 2:228074526-228074548 ACTGTTCTGGTGATAGTGAGTGG - Intronic
947296302 2:228634857-228634879 GCTGTTCTCATGATAGTGAATGG - Intergenic
947396835 2:229695011-229695033 GCTCTTTTCATGACAGTGAATGG + Intronic
947443313 2:230141956-230141978 GCTGTTCTCATGATAGTGAGTGG + Intergenic
947710702 2:232313915-232313937 GCTGTTCTCATGATAGTGAATGG - Intronic
947825023 2:233100006-233100028 TCTGTTCTCGTGATAGTGAATGG - Intronic
948037116 2:234866640-234866662 GCTGTTCTCATGACAGTGAGTGG - Intergenic
948366281 2:237457041-237457063 CCCTTTCTCCTGTCAGTGAATGG + Intergenic
948409604 2:237749028-237749050 GCTGTTCTCGTGATAGTGAGTGG - Intronic
948760598 2:240188094-240188116 GCTGGTCTCGTGATAGTGAATGG + Intergenic
948851361 2:240708674-240708696 GCTGTTCTCGTGATAGTGAATGG - Intergenic
948878759 2:240844788-240844810 GCTGTTCTCCTGATAGTGAGTGG + Intergenic
1168816579 20:741737-741759 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1169824553 20:9752949-9752971 CTTGTTCTCATGCCAGTGACAGG - Intronic
1169836984 20:9891185-9891207 GCTGTTCTCATGATAGTGAATGG - Intergenic
1169857853 20:10123381-10123403 GCTTTTCTTGTGATAGTGAATGG - Intergenic
1170037652 20:12005575-12005597 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1170710454 20:18786235-18786257 GCTGTTCTCATGATAGTGAATGG - Intergenic
1170710736 20:18788152-18788174 CTTGTTCTTGTGATAGTGAGTGG - Intergenic
1173098393 20:40060500-40060522 GCTGTTCTCATGATAGTGAATGG + Intergenic
1173389666 20:42621006-42621028 GCTGTTCTCCTGATAGTGAATGG - Intronic
1174121648 20:48270262-48270284 CCAGTTTTCCTGACACTGAAAGG + Intergenic
1174920260 20:54694553-54694575 ACTGTTCTCCTGAGAGTGAACGG - Intergenic
1175368423 20:58470890-58470912 CCAGTTCTGGAGACAGTGATGGG + Intronic
1175973880 20:62700555-62700577 CCTTCTCTCGTGACAATAAATGG + Intergenic
1176587626 21:8604103-8604125 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1176688910 21:9881008-9881030 GCTGTTCTCATGATAGTGAATGG - Intergenic
1176695863 21:9977463-9977485 GCTGTTCCTGTGATAGTGAATGG + Intergenic
1176696131 21:9979372-9979394 GCTGTTCTCATAATAGTGAATGG + Intergenic
1176919518 21:14670225-14670247 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1177068079 21:16464911-16464933 GCTGTTCTTGTGATAATGAATGG + Intergenic
1177213641 21:18101125-18101147 GCTGTTCTCATGATAGTGAATGG + Intronic
1177266869 21:18797411-18797433 TCTGTTCTCATGATAGTGAATGG + Intergenic
1177333575 21:19694265-19694287 GCTGTTCTCGTGATAGTGAACGG + Intergenic
1177839419 21:26219128-26219150 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177851172 21:26350390-26350412 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177900283 21:26906013-26906035 GCTGTTCTTGTGATGGTGAATGG + Intergenic
1177972892 21:27812223-27812245 ACTGTTCTCGTGATGGTGAATGG - Intergenic
1178013845 21:28318761-28318783 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1178019320 21:28391480-28391502 GCTTTTCTCATGATAGTGAATGG + Intergenic
1178143823 21:29716016-29716038 GCTGTTCTCATGATAGTGAATGG + Intronic
1178164510 21:29958146-29958168 GCTGTTCTGGTGATAGTGAATGG + Intergenic
1178295405 21:31405694-31405716 GCTGTTCCTGTGATAGTGAATGG - Intronic
1178322865 21:31618931-31618953 CCTGTTGTCATGATAGTGAGTGG + Intergenic
1178428370 21:32497874-32497896 GCTGTTGTCTTGATAGTGAAAGG - Intronic
1179065000 21:38016724-38016746 GCTTTTCTCATGATAGTGAATGG + Intronic
1179065269 21:38018653-38018675 GCTGTTCTCATGCTAGTGAATGG + Intronic
1179429694 21:41312022-41312044 GCGGTTCTCATGATAGTGAATGG - Intronic
1179450325 21:41464114-41464136 GCTGTTTTTGTGATAGTGAATGG + Intergenic
1180189709 21:46156847-46156869 GCTGTTTTTGTGATAGTGAATGG + Intergenic
1180270456 22:10581101-10581123 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1181383469 22:22525709-22525731 ACTGTCCTCGTGATAGTGAGTGG + Intergenic
1182189660 22:28445617-28445639 CATGTTCTGGGGACAGTGAGAGG - Intronic
1182357466 22:29728789-29728811 TCTGTTCTGGAGCCAGTGAATGG + Intronic
1182913257 22:34005309-34005331 GCTGTTCTGGAGATAGTGAATGG - Intergenic
1182913633 22:34008064-34008086 GCTGTTCTCGTGATAGTGGATGG - Intergenic
1182938368 22:34248911-34248933 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1183153695 22:36057629-36057651 GCTGTTCTTGTGATAGTGAATGG - Intergenic
949139725 3:617647-617669 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
949301819 3:2592518-2592540 GCTGTTCTCATGATAGTGAATGG + Intronic
949482929 3:4511116-4511138 CCTCTTCACGTAACAGTGACTGG + Intronic
950245145 3:11408726-11408748 GCTGTTCTCATGATAGTTAATGG - Intronic
951092952 3:18597170-18597192 GCTTTTCTGGTGATAGTGAATGG - Intergenic
951093212 3:18599039-18599061 GCTGTTCTCATGATAGTGAATGG - Intergenic
951385126 3:22032425-22032447 GCTGTTCTAGTGATAGTGAGGGG - Intronic
951500478 3:23381056-23381078 CCTGTTCTCCTGACTGGAAAGGG + Intronic
951758081 3:26114648-26114670 ACTGTTCTTGTGGTAGTGAATGG - Intergenic
953358494 3:42274800-42274822 ACTGTTCTGGTAACAGTGAATGG - Intergenic
953461580 3:43085435-43085457 GCTGTTCTCGTGATAGTGAATGG + Intronic
953898152 3:46820011-46820033 GCTGTTCTCGTGATAGTGAATGG + Intergenic
954256883 3:49413163-49413185 CCTGTGCTGGTGACAGAGAGGGG + Intronic
954516798 3:51185724-51185746 GCTGTTCTCATGATAGTGAATGG + Intronic
954595644 3:51821705-51821727 GCTGTTCTCGTGACAGTAAATGG + Intronic
954897166 3:53985607-53985629 ACTGTTCTGGTGATAGTGAGTGG + Intergenic
955042247 3:55329072-55329094 GCTGTTTTTGTGATAGTGAATGG - Intergenic
955471756 3:59294062-59294084 GCTGGTCTCATGATAGTGAATGG - Intergenic
955502094 3:59595592-59595614 GCTGTTCTCATGATAGTGAATGG + Intergenic
955748397 3:62163106-62163128 GCTGTTCCCGTGACAGTGAGTGG - Intronic
956348729 3:68311134-68311156 GCTGTTCTCTTGATAGTGAATGG - Intronic
956534410 3:70259976-70259998 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
956938457 3:74131038-74131060 GCTGTTCTCTTGATAGGGAATGG - Intergenic
956938730 3:74132969-74132991 GCTGTTCTCCTGAGAGTGAATGG - Intergenic
956986879 3:74711815-74711837 ACTGTTCTCGTGACAGCGAGTGG - Intergenic
957240790 3:77658842-77658864 GCTGTTCTCGTGATAGTGAATGG - Intergenic
957247088 3:77729288-77729310 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957459478 3:80497825-80497847 CCTGGGCCCCTGACAGTGAAGGG + Intergenic
957662962 3:83184602-83184624 GCTGTTCTTGTGATAGTGAATGG + Intergenic
957684489 3:83483346-83483368 GCTGTTCTCATGATAGCGAATGG + Intergenic
957759104 3:84532145-84532167 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957785446 3:84876354-84876376 GCTGTTCTCATGATAGTGATTGG + Intergenic
957955790 3:87185407-87185429 GCTGTTCTCATGATAGTGAGTGG - Intergenic
958149271 3:89669716-89669738 GGTGTTCTCATGATAGTGAAGGG + Intergenic
958149538 3:89671662-89671684 GTTGCTCTCGTGATAGTGAATGG + Intergenic
958525073 3:95246708-95246730 GCTGTTCTCGTGATAGTGAATGG + Intergenic
958592729 3:96179712-96179734 CCTGTCTTCATGACAGGGAATGG + Intergenic
958823331 3:99001852-99001874 GCTGTTCTCGTGATAGTAAATGG - Intergenic
958823612 3:99003835-99003857 GCTGTTCTCATAATAGTGAATGG - Intergenic
958847900 3:99287417-99287439 TCTGGTCTCATGATAGTGAATGG + Intergenic
959054594 3:101554620-101554642 GCTGTTCTCATGATAGTGAATGG + Intergenic
959155239 3:102658869-102658891 GCTGTACTCGTGATAGGGAATGG + Intergenic
959174052 3:102882697-102882719 GCTGTTCTCATGATAGTGAATGG + Intergenic
959196738 3:103192856-103192878 GCTGTTCTCGTGATAGTGAATGG - Intergenic
959216423 3:103455863-103455885 GCTGTTCTCGTGATAGTGAATGG + Intergenic
959318971 3:104847194-104847216 GCTGTACTTGTGACAGTGAATGG + Intergenic
959364191 3:105436082-105436104 CTGGTTCTTGTGACAGTGAATGG - Intronic
959718026 3:109454988-109455010 GCTGTTCTTGTGACGGTGAGTGG - Intergenic
959741988 3:109731080-109731102 ACTGTTCTCATGACAGTGAATGG - Intergenic
959803467 3:110523848-110523870 GCTGGTCTCGTGATAGTGAACGG + Intergenic
959803692 3:110525760-110525782 GCTGTTCTCGTGATAGTAAATGG + Intergenic
960224423 3:115152695-115152717 GCTGTTCTCATGATAGTGAATGG + Intergenic
960478500 3:118159817-118159839 GCTGTTCTCAAGATAGTGAATGG - Intergenic
960545199 3:118906325-118906347 CCTGTCCCCTTGACAGTGAGTGG - Intronic
960834994 3:121896836-121896858 CCTGTAATTGTGCCAGTGAATGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961067658 3:123890120-123890142 GCTGTTCTCATGATAGTGAATGG - Intergenic
962500338 3:135984969-135984991 CCTGTTCTCGTGACAGTGAATGG - Intronic
963011805 3:140776997-140777019 GCAGTTCTCTTGATAGTGAATGG - Intergenic
963280599 3:143381286-143381308 GCTGTTCTTGTGACAGTGAATGG + Intronic
963421181 3:145062515-145062537 CCTGTTCCTGTGATAGTGAATGG - Intergenic
963477461 3:145824916-145824938 GCTGTTCTTGTGATAGTTAATGG + Intergenic
963532297 3:146485932-146485954 GCTGTTCTCATGATAGTGAATGG - Intronic
963952705 3:151220583-151220605 GCTGTTCTTGTGATAGTGAATGG + Intronic
963952970 3:151222495-151222517 GCTGTTCTTGTGATAGTGGATGG + Intronic
964186179 3:153946256-153946278 GCTGTTCTCATGATAGTGAGAGG + Intergenic
964677654 3:159301619-159301641 GCTGTTCTCGTGATAGTGAGTGG + Intronic
964719231 3:159755415-159755437 GCTGTTCTCATGATAGTGAATGG - Intronic
964803307 3:160578471-160578493 GCTGTTCTCATGATAGTGAATGG + Intergenic
965146713 3:164914048-164914070 GCTGTTCATGTGATAGTGAATGG - Intergenic
965178557 3:165368022-165368044 CCTGTGCTAGTGATAGTGACAGG - Intergenic
965198497 3:165628483-165628505 TCTGTTCTCATGACAGTGAATGG - Intergenic
965198732 3:165630268-165630290 GCTGCTCTAGTGATAGTGAATGG + Intergenic
965809491 3:172577357-172577379 GCTGTTCTTTTGACAGTGAATGG + Intergenic
965838680 3:172879475-172879497 GCTGTTCTTGTGATAGTGAATGG + Intergenic
965838951 3:172881402-172881424 GCTGTTCTTGTGTTAGTGAATGG + Intergenic
965856157 3:173090197-173090219 ACTGTTCTCATGATAGTGAGTGG + Intronic
966059047 3:175733421-175733443 GCTATTCTTGTGATAGTGAATGG - Intronic
967255145 3:187583686-187583708 GCTGTTCTCCTGATAGTGAATGG - Intergenic
967396173 3:189011613-189011635 GCTCTTCTCATGATAGTGAATGG - Intronic
967462151 3:189760008-189760030 GCTGTTTTTGTGATAGTGAATGG - Intronic
967505386 3:190247191-190247213 GCTGTTCTCATGATAGTGAATGG - Intergenic
967528230 3:190518771-190518793 GCTATTCTCGTGATAGTGAATGG - Intronic
967976849 3:195040344-195040366 CCCGTTCTGGGCACAGTGAAAGG - Intergenic
968550487 4:1220987-1221009 CGTGTTCTCGTCACAGAGAGAGG + Intronic
968577008 4:1371716-1371738 GCTGTCCCCGTGAGAGTGAATGG - Intronic
969119461 4:4897347-4897369 CCTGTTCTCGTGATAGTGAGTGG - Intergenic
969432368 4:7162863-7162885 CCTGTTCGCGTGATTGTGGATGG + Intergenic
969974316 4:11082325-11082347 GCTGTTCTCATGATAGTGAATGG + Intergenic
970157366 4:13154562-13154584 GCTGTTCTTGTGACAGAAAATGG - Intergenic
970329689 4:14966819-14966841 GCTGTTCTCATTACAGTGAATGG - Intergenic
970554400 4:17216514-17216536 GCTGTTGTTGTGATAGTGAATGG - Intergenic
970707870 4:18826706-18826728 GCTGTTCTTGTGATAGTGAATGG - Intergenic
970769231 4:19590643-19590665 GCTGTTCTCTTGACAGTGACTGG - Intergenic
970802177 4:19986043-19986065 GCTGTTCTCGTGACAATAAATGG + Intergenic
970990674 4:22209614-22209636 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
971133496 4:23839861-23839883 GCTGTTGTCGTGATAGTGAATGG - Intronic
971299310 4:25428764-25428786 GCTGTTCTCATGATAGTGAATGG - Intergenic
971411681 4:26379585-26379607 GCTGTTCTCATGATAGTGAGTGG - Intronic
971460634 4:26891978-26892000 GCTGTTCTCATGATAGTGAATGG + Intronic
971687588 4:29788565-29788587 GTTGTTCTCATGACACTGAATGG - Intergenic
971844989 4:31906905-31906927 GCTGTTCTTGTGAGAGTGAATGG - Intergenic
972190784 4:36588045-36588067 ACTGTTCTCATGAAAGTGAATGG + Intergenic
972370411 4:38418582-38418604 GCTGTTCTAGTGATAGTGAATGG - Intergenic
972370691 4:38420516-38420538 GCTGTTCTAGTGATAGTGAATGG - Intergenic
972467376 4:39370250-39370272 GCTGTTCTCATGATAGTGAATGG + Intergenic
972467646 4:39372184-39372206 GCTGTTCTCGTAATAGTGAATGG + Intergenic
972849981 4:43036364-43036386 TCTGTTCTTGTGATAGTGAATGG + Intergenic
972935985 4:44136214-44136236 GCTGTTCTTGTGACAGTAAATGG + Intergenic
972987914 4:44787449-44787471 ATTGTTCTCGTGACAGTGAAGGG + Intergenic
973038696 4:45443128-45443150 GCTGTTCTCATGACAATGAATGG + Intergenic
974202669 4:58662078-58662100 GATGTTCTCCTGATAGTGAATGG - Intergenic
974230037 4:59100119-59100141 GCTGTTCTCGTGATGGTGAATGG - Intergenic
974341211 4:60616699-60616721 GCTGTTCTTGTGATAGTGAATGG + Intergenic
974476099 4:62382517-62382539 GCTGTTCTCGTGATAGTGAATGG - Intergenic
974850945 4:67404678-67404700 CCTTTGCTCTTGACAGTGCAGGG - Intergenic
975161351 4:71128312-71128334 GCTGTTCTCATGATTGTGAATGG - Intergenic
975200488 4:71582526-71582548 GCTGTTCTTGTGATAGTGAATGG + Intergenic
975230100 4:71923141-71923163 GCTGCTCTTGTGACAGTGAGTGG + Intergenic
975335943 4:73175305-73175327 GCTGTTCTTGTAATAGTGAATGG - Intronic
975390921 4:73816484-73816506 GCTGTTCTCATGATAGTGAATGG + Intergenic
975543178 4:75535150-75535172 GCTGTTCTCATGATAGTGAATGG - Intronic
976368824 4:84263153-84263175 GCTGTTCTCATGATAGTGAGTGG - Intergenic
976440529 4:85068356-85068378 GCTGTTCTTGTGACAGTGAATGG - Intergenic
976515830 4:85965294-85965316 GCTGTTCTCATGATAGTGAATGG - Intronic
976668632 4:87627448-87627470 GCTGTTCTTGTGATAGTGAGTGG - Intergenic
976703164 4:87993219-87993241 GCTGTTCTCGTGATAATGAGTGG + Intergenic
976975029 4:91155257-91155279 GCTGTTCTTGTGATACTGAATGG + Intronic
976986474 4:91305905-91305927 GCTGTTCTCGTGATAGTGAGGGG - Intronic
976987807 4:91325007-91325029 ATTGTTCTAGTGATAGTGAATGG + Intronic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
977443082 4:97095179-97095201 GCTGTTCTCATGATAGTGAGTGG - Intergenic
977705523 4:100066430-100066452 GCTGTTCTTGTGATAGTGAATGG - Intergenic
977728727 4:100326716-100326738 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978028053 4:103902315-103902337 GCTGTTCTCATGATAGTGAATGG - Intergenic
978059395 4:104317675-104317697 ACTGTTCTTGTGACAGTGAATGG + Intergenic
978392303 4:108240053-108240075 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978645096 4:110920570-110920592 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
978704598 4:111691773-111691795 GCTGTTCTCATGATAGTGAATGG - Intergenic
979147130 4:117257971-117257993 GCTGTTCTTGTGATAGTGAATGG + Intergenic
979369086 4:119862278-119862300 GCTGTTCTCATGATAGTGAATGG - Intergenic
979389972 4:120117137-120117159 GCTGTTCTCATGATAGGGAATGG - Intergenic
979390259 4:120119076-120119098 GCTGTTCTCATGATAGTGAATGG - Intergenic
979426547 4:120573660-120573682 GCTGTTCTCATGATAGTGAAGGG - Intergenic
979496014 4:121383161-121383183 GATGTTCTCATGATAGTGAATGG + Intergenic
980270201 4:130574448-130574470 CCTGTTTCCATGACAATGAAAGG - Intergenic
980352295 4:131698822-131698844 GCTGTTCTCATGATAGTGAATGG - Intergenic
980352554 4:131700762-131700784 GCTGTTCTCGTAATAGTGGATGG - Intergenic
980366165 4:131807467-131807489 GCTGTTCTCGTGACAGTAATGGG - Intergenic
980368484 4:131837703-131837725 GCTGTTGCCGTGATAGTGAATGG + Intergenic
980368740 4:131839600-131839622 GCTGTTCTCATAATAGTGAATGG + Intergenic
980388416 4:132115585-132115607 GCTGTTCTCATGATAGTGAATGG + Intergenic
981286922 4:143028233-143028255 GATGTTCTCATGATAGTGAATGG + Intergenic
981902987 4:149888712-149888734 GCTGTTCTTGTGATAGTGAATGG - Intergenic
982436551 4:155387550-155387572 GCTGTCCTCGTGATAGTGAATGG - Intergenic
982494298 4:156071146-156071168 GCTGTTCTCATGATAGTGAATGG - Intergenic
982554412 4:156841284-156841306 GCTGTTCTCATGATAGTGAGTGG + Intronic
982758944 4:159257428-159257450 GCTGTTCTCATGATAGTGAATGG - Intronic
982780274 4:159483145-159483167 CCTGTTCTCTTGAAAATAAATGG + Intergenic
982901951 4:161017130-161017152 GCTCTTCTCATGACAGTGAATGG + Intergenic
983636023 4:169898679-169898701 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
983668948 4:170214042-170214064 GCTGTTCTTGTCATAGTGAATGG + Intergenic
983669214 4:170216117-170216139 GCTGTTCTCATGATAGTGAATGG + Intergenic
983832258 4:172341615-172341637 GCTGTTCTGGTGATAGTGAATGG + Intronic
984479935 4:180287272-180287294 GTTGTTCTCGTGATAGTGAATGG - Intergenic
984616563 4:181904883-181904905 GCTGTTCTCATGATAGCGAATGG + Intergenic
984811974 4:183803146-183803168 GCTATTCTCATGATAGTGAATGG - Intergenic
985304046 4:188520023-188520045 GCTGTTCTTGTGATAGTGAATGG + Intergenic
986473983 5:8106496-8106518 GCTGTTCTGATGATAGTGAATGG + Intergenic
986633009 5:9792910-9792932 CATATTCTCTTGAAAGTGAAGGG + Intergenic
986756885 5:10845044-10845066 TCTGTTCTCATGATAGTGAATGG - Intergenic
986764420 5:10911876-10911898 CCTGTTTGAGTGACAGTGAAGGG + Intergenic
986807346 5:11320695-11320717 GCTGTTCTCATGATAGTGAATGG - Intronic
986878968 5:12146969-12146991 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
987166624 5:15204629-15204651 GCTGTTCTCATGACAGTGAGTGG + Intergenic
987215366 5:15731411-15731433 GCTGTTCCTGTGATAGTGAATGG - Intronic
987384250 5:17313959-17313981 GCTGCTCTTGTGATAGTGAATGG + Intergenic
987737002 5:21859385-21859407 GCTGTTCTCATGATAGTGAGTGG - Intronic
987743214 5:21936779-21936801 GCTGTTCTTGTGATAGTGAGGGG + Intronic
987773413 5:22335301-22335323 GCTGTTCTTGTGATAGTGAATGG + Intronic
988212817 5:28227918-28227940 GCTGTTCTCATGATAGTGAATGG + Intergenic
988508484 5:31845003-31845025 CATGTTTTCGAGACTGTGAAAGG + Intronic
988866811 5:35344126-35344148 GCTGTTCTCATGATAGTGAATGG - Intergenic
988884275 5:35538341-35538363 ACTGTTCTTGTGATAGTGAGTGG + Intergenic
988888201 5:35582408-35582430 GCTGTTCTCATGATAGTGAATGG - Intergenic
988892338 5:35631236-35631258 GCTGTTCTCGTGATAGTGAATGG - Intronic
988898090 5:35700002-35700024 GCTGTTTTCGTGATAGTGAATGG + Intronic
989546015 5:42674191-42674213 CCTGTTTTTGTGACAGTGACAGG + Intronic
989585183 5:43068868-43068890 GCTGTTCTCGTGTTAGTGAGTGG + Intronic
989675528 5:43968130-43968152 GCTGTTCTCATGATAGTGAATGG + Intergenic
990000883 5:50891396-50891418 ACTGTTCTTGTGATAGTGAGTGG - Intergenic
990588920 5:57242268-57242290 CCTATGCTAGTGACAGTGTATGG + Intronic
991143373 5:63273290-63273312 GCTGTTCCTGTGATAGTGAATGG - Intergenic
991158476 5:63466775-63466797 GCTGCTCTTGTGACAGTGAGTGG + Intergenic
991409250 5:66330487-66330509 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
991615889 5:68496939-68496961 GCTGTTCTCATAATAGTGAATGG + Intergenic
991616168 5:68498884-68498906 GCTGTTCTTGAGATAGTGAATGG + Intergenic
991749703 5:69787752-69787774 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
991763407 5:69946888-69946910 GCTGTTCTTGTGATAGTGAGGGG + Intergenic
991783920 5:70171241-70171263 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
991801282 5:70367566-70367588 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
991827317 5:70642476-70642498 GCTGTTCTTGTGATAGTGAGGGG + Intergenic
991842636 5:70821948-70821970 GCTGTTCTTGTGATAGTGAGGGG + Intergenic
991876365 5:71171616-71171638 GCTGTTCTTGTGATAGTGAGGGG - Intergenic
992478523 5:77127292-77127314 GCTGTTCTCGTGATAATGAGTGG + Intergenic
992517533 5:77510283-77510305 GCTGTTCTTGTGAGAGTGAATGG - Intronic
992826397 5:80553947-80553969 GCTGTTCTCGTGATAGTGAATGG + Intergenic
992854717 5:80848669-80848691 GCTGTTCTCATGACAGTGAATGG - Intronic
993164118 5:84330227-84330249 CCTTTTCTCTTTACATTGAAAGG - Intronic
993293669 5:86108010-86108032 GCTGTTCTTGTGATGGTGAATGG + Intergenic
993791123 5:92212527-92212549 GCTGTTCTTGTGATAGTGAATGG - Intergenic
993896085 5:93536887-93536909 GCTGTTCTCGAGATAGTGAGTGG + Intergenic
994352008 5:98756955-98756977 ACTGTTCTCGTGATAGTGAATGG + Intergenic
994542664 5:101120701-101120723 GCTGTTCTCATGATAGTTAATGG - Intergenic
994542943 5:101122573-101122595 GTTGTTCTCATGATAGTGAATGG - Intergenic
994614111 5:102081811-102081833 GCTGTTCTCATGATAGTGAATGG - Intergenic
994696204 5:103075560-103075582 GCTGTTCTCATGATAGTGAATGG + Intergenic
994799118 5:104348164-104348186 GCTGTTCTTATGATAGTGAATGG - Intergenic
994801395 5:104381458-104381480 GCTGTTCTTGTGATAGTTAATGG - Intergenic
994813871 5:104558094-104558116 GCTGTTCTCTTGATAGTGAGGGG - Intergenic
995025478 5:107416230-107416252 CCTGTTCTCAAGACAGCTAATGG - Intronic
995132617 5:108646588-108646610 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
995428981 5:112053710-112053732 GCTGTTCTCATTATAGTGAATGG + Intergenic
995464022 5:112432190-112432212 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
996111387 5:119570381-119570403 CCTGTCCTAGTCACAGAGAAGGG + Intronic
996214193 5:120847963-120847985 GCTGTTCTTGTGATAGTGAATGG - Intergenic
996297698 5:121942514-121942536 GCTATTCTCATGACAGTGAATGG - Intergenic
996460332 5:123733498-123733520 GCTGTTCTTGTGATAGTAAATGG + Intergenic
996600039 5:125252772-125252794 GCTGTTCTCGTGATAGTAAATGG - Intergenic
996600307 5:125254706-125254728 GCTGTTCTCATGATGGTGAATGG - Intergenic
996647303 5:125831637-125831659 CCTGTTTTGGTGATAGTGAATGG + Intergenic
996768187 5:127056538-127056560 GCTGTTCTTGTGATAGTGAATGG - Intronic
997032299 5:130145057-130145079 GCTGTTCTCATGATAGTGAGTGG - Intronic
998715299 5:144876773-144876795 GCTGTTCTAGTGATAGTGAATGG - Intergenic
998793408 5:145791206-145791228 CCTGTTCTCTTGGTAGTGATGGG - Intronic
999020963 5:148164753-148164775 GTTGTTCCCGTGATAGTGAATGG + Intergenic
999133133 5:149299694-149299716 CATGTTCTTGAGTCAGTGAAGGG - Intronic
999137454 5:149331998-149332020 CATCTTCTGGTGACAGTGATTGG - Intronic
999594553 5:153188269-153188291 GCTATTCTTGTGATAGTGAATGG - Intergenic
999793845 5:154969212-154969234 GCTGTTCTCGTGATAGTGAGTGG + Exonic
1000034681 5:157436199-157436221 GCTGTTCCTGTGACAGTGAATGG + Intronic
1000228980 5:159297572-159297594 ACTGTTCTCTTGATAGTGAATGG - Intergenic
1000261836 5:159595826-159595848 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1000639290 5:163682486-163682508 GCTATTCTCATGATAGTGAATGG + Intergenic
1001240461 5:170065716-170065738 GCTGTTCTTGTGATAGTGAATGG - Intronic
1003470395 6:6424587-6424609 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1003649198 6:7943001-7943023 GCTGCTCTCTTGATAGTGAACGG + Intronic
1003669226 6:8140116-8140138 CCAGTGCTCTTGACAGTGACTGG - Intergenic
1003818308 6:9866280-9866302 GCTGCTGTCGTGATAGTGAATGG + Intronic
1004703466 6:18101146-18101168 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1005089860 6:22045117-22045139 GCTGTTTTCTTGACAGTAAATGG + Intergenic
1005162409 6:22879461-22879483 CCTGTTGAGGTGACAGAGAAAGG - Intergenic
1005331459 6:24754663-24754685 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1005794373 6:29342674-29342696 TCTGTTCTCATGACAGTGAGTGG - Intergenic
1005802767 6:29444140-29444162 GCTGTTCTTGTGATAGTGAATGG + Intronic
1006254035 6:32815043-32815065 CCTTTTCTCCCCACAGTGAAGGG + Exonic
1006280217 6:33046496-33046518 GCTGTTCTTGTGACAGTGAATGG + Intergenic
1006696717 6:35937063-35937085 ACTATTCTTGTGATAGTGAATGG + Intergenic
1008248330 6:49206823-49206845 GCTGTTCTCATGATAGTGAATGG - Intergenic
1008248583 6:49208769-49208791 TCTGTTCTTGTGATAGTGAATGG - Intergenic
1009300159 6:62008707-62008729 GCTGTTCTCATGATATTGAATGG + Intronic
1009757450 6:67957386-67957408 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1009820393 6:68792644-68792666 CCACATCTCTTGACAGTGAAAGG - Intronic
1009824923 6:68855990-68856012 GCTGTTCTCATGATAGTGAATGG + Intronic
1009876533 6:69512491-69512513 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1010282723 6:74039321-74039343 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1010396016 6:75392782-75392804 GCTGTTCTCATGATAGTGAATGG + Intronic
1010511949 6:76730584-76730606 GCTGTTCTCATGATAGTGAATGG + Intergenic
1011110761 6:83834529-83834551 GCTGTTCTCATGATAGTGAATGG + Intergenic
1011167975 6:84471583-84471605 GCTATTCTCATGATAGTGAATGG + Intergenic
1011895127 6:92215979-92216001 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1011957994 6:93047631-93047653 CCTCTTCTTGTGCCACTGAATGG - Intergenic
1012541421 6:100366347-100366369 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1012811800 6:103968086-103968108 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1013039768 6:106421947-106421969 GCTGTTCTCATGATAGTGAATGG - Intergenic
1013227233 6:108128768-108128790 GCTGTTCTCATGATAGTGAGTGG + Intronic
1013417850 6:109940474-109940496 GCTGTTCTCATGGTAGTGAATGG + Intergenic
1013470809 6:110462106-110462128 GCTGTTCTTGTGACAGTAAAAGG - Intronic
1013927596 6:115492535-115492557 GCTGTTCTCATGATAGTGAATGG - Intergenic
1013928004 6:115495630-115495652 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1014061249 6:117074100-117074122 GCTGTTCTGGTGATAGTGAGTGG + Intergenic
1014067995 6:117149877-117149899 GCTGTTCTCATGATAGTGAATGG - Intergenic
1014068276 6:117151819-117151841 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1014247858 6:119085930-119085952 GCTGTTCTCATGATAATGAATGG - Intronic
1014579916 6:123124359-123124381 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1014754930 6:125292310-125292332 CCAGTGCTGCTGACAGTGAAGGG - Intronic
1014861100 6:126469234-126469256 GCCGTTCTTGTGACAGTGAGGGG + Intergenic
1015013053 6:128375436-128375458 GCTATTCTCGTGATAATGAATGG - Intronic
1015013316 6:128377382-128377404 GCTATTCTCGTGTTAGTGAATGG - Intronic
1015161678 6:130159180-130159202 GCTGTTCTCATGGTAGTGAATGG + Intronic
1015194571 6:130510908-130510930 GCTGTTCTCCTGATAGTGAAGGG + Intergenic
1015217025 6:130762086-130762108 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1015490819 6:133823658-133823680 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1015660777 6:135571242-135571264 GCTGTTCTCATGATAGTGAATGG + Intergenic
1015873929 6:137803527-137803549 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1016139602 6:140592978-140593000 GCTGTTCTCATGAAAGTAAATGG + Intergenic
1016139904 6:140595231-140595253 GCTGTTTTTGTGAGAGTGAATGG + Intergenic
1016337752 6:143026173-143026195 GCTTTTCTTGTGATAGTGAATGG - Intergenic
1016358791 6:143246443-143246465 GCTGTTCTTGTGATAGTGAATGG - Intronic
1016537494 6:145125280-145125302 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016537760 6:145127219-145127241 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016649467 6:146447665-146447687 GCTGTTCTCATGATAGTGAATGG - Intergenic
1016649733 6:146449594-146449616 GCTGTTCTCATGATAATGAATGG - Intergenic
1016862155 6:148731469-148731491 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017062140 6:150493732-150493754 ACTGTTCCCATGACAGTGAATGG + Intergenic
1017342173 6:153336507-153336529 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017424608 6:154307254-154307276 GCTGTTCTCATGATAGTGAATGG + Intronic
1017532296 6:155307483-155307505 GCTGTTCTCATGATAGTGGATGG - Intronic
1017601908 6:156092589-156092611 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1017618085 6:156266270-156266292 GCTGTTCTTGTCATAGTGAATGG - Intergenic
1017816273 6:158018750-158018772 CCTGTTCCCGTTACTGTAAACGG - Intronic
1018473022 6:164113082-164113104 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1019697978 7:2458258-2458280 CCTTTCCTCGTGGCAGTGGAGGG - Intergenic
1020581659 7:10010716-10010738 AGTGTTCTCATGACAGTGAGTGG + Intergenic
1020782578 7:12535403-12535425 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1020979615 7:15052075-15052097 GCAGTTCTGGTGATAGTGAATGG - Intergenic
1021036712 7:15809109-15809131 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1021570842 7:22063498-22063520 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1021621464 7:22554309-22554331 GCTGTTCTCATGATAGTGAAGGG - Intronic
1022458061 7:30576704-30576726 GCTGTTCTCATGATAGCGAATGG - Intergenic
1022701818 7:32768592-32768614 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1022906050 7:34858750-34858772 GCTGTTCTTGTGATAGTGAATGG - Intronic
1023188289 7:37553536-37553558 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1023265098 7:38396276-38396298 GCTGTTCTCATGATAGTGACTGG + Intronic
1023709645 7:42977858-42977880 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1024307116 7:47938346-47938368 CCTGTTCTCGTCACAGAAGAGGG - Intronic
1024328202 7:48130146-48130168 TCTGTTCTCGTGATAGTGAATGG - Intergenic
1024384900 7:48739596-48739618 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1024391676 7:48820339-48820361 CCTGTTCTCTTGGCTTTGAAAGG + Intergenic
1024845330 7:53635541-53635563 GCTGTTCTCATGATAATGAATGG + Intergenic
1024894491 7:54242111-54242133 GCTATTCTTGTGATAGTGAATGG + Intergenic
1025153160 7:56576488-56576510 TTTCTTCTCATGACAGTGAAAGG + Intergenic
1027913554 7:84284306-84284328 CTAGTTCTCCTGACAGTCAAAGG + Intronic
1027968437 7:85043695-85043717 GCTGTTCTCGTGATAGTGAATGG + Intronic
1028042048 7:86064677-86064699 GCTGTTCTCATGATAGTGAATGG + Intergenic
1028063812 7:86355742-86355764 GCTGTTCTAGTGATAGTAAATGG - Intergenic
1028250214 7:88531321-88531343 GCTGGTCTCGTGATAGTGAATGG + Intergenic
1028314372 7:89382604-89382626 GTTGTTCTGGTGATAGTGAATGG + Intergenic
1028314613 7:89384547-89384569 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1028348505 7:89814065-89814087 GCTGTTCTCATGATAGAGAATGG - Intergenic
1028359875 7:89955186-89955208 GCTGTTCTCATGATAGTGAATGG - Intergenic
1028360152 7:89957122-89957144 GCTGTTCTCATGATAGTGAATGG - Intergenic
1028817790 7:95167247-95167269 GCTGTTCTTGTGATAGTGAATGG - Intronic
1030412946 7:109204557-109204579 CCTGTTCTCATGATAGTGAATGG - Intergenic
1030783011 7:113624985-113625007 GCTCTTCTCGTGACAGTGAATGG - Intergenic
1030838600 7:114319604-114319626 GTTGTTCTTGTGATAGTGAATGG - Intronic
1030904146 7:115162236-115162258 GCTGTTCTCATGATAGTGAATGG - Intergenic
1031177467 7:118371226-118371248 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1031298717 7:120038375-120038397 GCTGTTCTGGTGTTAGTGAATGG - Intergenic
1031301488 7:120067027-120067049 GCTGTTCTCATGATAGTGAATGG + Intergenic
1031301745 7:120068955-120068977 GCTGTTCTCATGATAGTGAATGG + Intergenic
1031650604 7:124284968-124284990 GCTGTTCTCATGATAGTGAGAGG + Intergenic
1031729205 7:125277081-125277103 GCTGTTCTCATGATAGTGTATGG + Intergenic
1032442998 7:131956475-131956497 GCTGTTCTCGTGATAGTAAATGG + Intergenic
1033000755 7:137501934-137501956 GCTGTTCTCATGATAGTGAATGG + Intronic
1033036335 7:137879416-137879438 CCTGTTTTCATGACAGAGAAGGG - Exonic
1033224839 7:139553253-139553275 GCTGTTCTCATGATGGTGAATGG + Intergenic
1033356979 7:140607858-140607880 CTTGTCCTAGTGCCAGTGAAAGG - Intronic
1033403131 7:141046405-141046427 GCTGTTCTTGTGATACTGAATGG - Intergenic
1033487579 7:141805938-141805960 GCTATTCTTGTGATAGTGAAAGG + Intergenic
1033717612 7:144018997-144019019 GTTGTTCTCATGATAGTGAATGG - Intergenic
1033805254 7:144946862-144946884 GCTGTTCTCATGATAGTGAATGG - Intergenic
1034052086 7:147994546-147994568 ACTGTTCTCATGATAGTGAATGG + Intronic
1034450639 7:151135411-151135433 CCTGTGCTTGTCACAGTGAGGGG + Intronic
1034689149 7:153000133-153000155 GCTGTTCTCATGATAGTGAGGGG - Intergenic
1034739551 7:153461434-153461456 ACTGTTCTCTTGGTAGTGAATGG + Intergenic
1035469514 7:159100693-159100715 ACTGTTCTTGTGGTAGTGAACGG + Intronic
1035469520 7:159100745-159100767 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469530 7:159100797-159100819 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469538 7:159100852-159100874 ACTGTTCCTGTGATAGTGAATGG + Intronic
1035469556 7:159100959-159100981 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469590 7:159101173-159101195 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469600 7:159101228-159101250 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469610 7:159101283-159101305 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469690 7:159101763-159101785 ACTGTTCCTGTGACAGTGAACGG + Intronic
1035469729 7:159102026-159102048 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469758 7:159102188-159102210 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469765 7:159102240-159102262 ACTGTTCCTGTGATAGTGAATGG + Intronic
1036039055 8:5054127-5054149 GCAGTTCTTGTGATAGTGAATGG - Intergenic
1036123291 8:6040907-6040929 GCTGTTCTCATGACAGTGAATGG - Intergenic
1036914409 8:12790900-12790922 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1037200855 8:16250538-16250560 GCTGTTCTTGTGACAGTGAATGG - Intronic
1037298643 8:17428060-17428082 GCTGTTCTCATGATAGTGAATGG - Intergenic
1038346783 8:26740428-26740450 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1038746741 8:30261416-30261438 GCTCTTCTCGTGATAGTGAATGG + Intergenic
1038814287 8:30885317-30885339 GCTATTCTCATGATAGTGAATGG + Intronic
1039076547 8:33695161-33695183 GCTCTTCTTGTGATAGTGAATGG + Intergenic
1039121804 8:34156409-34156431 GCTGTTCTCATGATAGTGAATGG + Intergenic
1039122080 8:34158350-34158372 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1039148557 8:34478310-34478332 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
1039185849 8:34915501-34915523 GCTGTTCACTTGATAGTGAAGGG + Intergenic
1040005127 8:42614016-42614038 GCTGTTCTTGTGATAGTTAATGG - Intergenic
1040802047 8:51352502-51352524 GCTGTTCTCATGATAGTGAGGGG + Intronic
1040966187 8:53083075-53083097 GTTGTTCTCATGATAGTGAATGG + Intergenic
1041312019 8:56526693-56526715 GCTGTTCTTGTGACAGTGAGAGG - Intergenic
1041443021 8:57918908-57918930 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1041551119 8:59102567-59102589 GCTGTTCTTGTGATAGTGAACGG - Intronic
1041953905 8:63536531-63536553 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1041953910 8:63536566-63536588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1042428522 8:68676943-68676965 GCTCTTCTCATGATAGTGAATGG - Intronic
1042462070 8:69081057-69081079 CTTGTTCTCATGATAGTGAATGG + Intergenic
1042660915 8:71153528-71153550 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1042684478 8:71422778-71422800 GCTGTTCTCCTGATAGTGATGGG - Intronic
1043078943 8:75740232-75740254 GCTGTTTTCATGATAGTGAATGG - Intergenic
1043080732 8:75761566-75761588 ACTGTTCTCGTAAAAGTGAATGG + Intergenic
1043492352 8:80762497-80762519 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1043518421 8:81018568-81018590 GCTGTTCTCATGATGGTGAATGG + Intronic
1044043302 8:87397840-87397862 GTTGTTCTCATGATAGTGAATGG + Intronic
1044181807 8:89205476-89205498 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1044640495 8:94375380-94375402 GCTGTTCTTGTGATAATGAATGG + Intronic
1045093268 8:98769351-98769373 GCTGTTCTCATGATAGTGAATGG + Intronic
1045176188 8:99727614-99727636 GCTATTCTTGTGATAGTGAATGG - Intronic
1045249434 8:100471024-100471046 ACTGTTCTCATGATAGTGAATGG + Intergenic
1045939931 8:107727670-107727692 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1046003409 8:108448479-108448501 GCTGTTCTCATTATAGTGAATGG + Intronic
1046044329 8:108946339-108946361 GCTGTACTTGTGATAGTGAATGG - Intergenic
1046851987 8:118984955-118984977 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1047149023 8:122240228-122240250 GCTGTTCTCATGATAGTGAATGG + Intergenic
1047149284 8:122242151-122242173 GCTGTTCTTGTCATAGTGAATGG + Intergenic
1047513454 8:125532942-125532964 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1047876167 8:129139994-129140016 GCTGTGCTTGTGATAGTGAATGG + Intergenic
1047920608 8:129630822-129630844 GCTGTTCTCATGACAGTGAATGG - Intergenic
1048027667 8:130601524-130601546 GCTGTTCTAGTGACAGTGAATGG + Intergenic
1048057301 8:130879974-130879996 GCGATTCTCGTGATAGTGAATGG + Intronic
1048137873 8:131763866-131763888 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1048234856 8:132679694-132679716 TCTGTTCTCGTGATAGTAAATGG + Intergenic
1048264950 8:132977685-132977707 GCTATTCTCGTGATAGCGAATGG - Intronic
1048722703 8:137344721-137344743 GCTGTTCTTGTTATAGTGAATGG + Intergenic
1048769592 8:137881625-137881647 CTTGTTCTCCTGATAGTGAATGG + Intergenic
1048907559 8:139103193-139103215 GCTGTTCTCATGATAGTGAATGG - Intergenic
1049863001 8:144913192-144913214 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1050337674 9:4605185-4605207 CCTGTTGTCCTGAGATTGAATGG - Intronic
1050430397 9:5556246-5556268 CCTGTTGTGGGGACAGTGAGAGG + Intronic
1051015989 9:12475802-12475824 GCAGTTCTCATGACAGTGAATGG + Intergenic
1051070181 9:13156542-13156564 GCTGTTCTCCTGATAGTAAATGG - Intronic
1051394601 9:16606487-16606509 GCTATTCTCTTGACAGTGAATGG + Intronic
1051560472 9:18435834-18435856 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1051743466 9:20273509-20273531 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051837253 9:21354250-21354272 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051957325 9:22712165-22712187 ACTGTTCTCATGATAGTGAATGG + Intergenic
1052006858 9:23359949-23359971 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1052007172 9:23362195-23362217 GGTGTTCTTGTGATAGTGAATGG - Intergenic
1052077825 9:24165838-24165860 GCTGTTCTCGTGGTAGTGAGTGG + Intergenic
1052196104 9:25716642-25716664 GCTATTCTCGTGATAGTGAGGGG + Intergenic
1052599181 9:30601538-30601560 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1053632846 9:39963418-39963440 GCTGTTCCCATGATAGTGAATGG + Intergenic
1053633110 9:39965324-39965346 GCTGTTCTCATAATAGTGAATGG + Intergenic
1053772641 9:41498209-41498231 GCTGTTCTCATAATAGTGAATGG - Intergenic
1053772912 9:41500115-41500137 GCTGTTCCCATGATAGTGAATGG - Intergenic
1053780155 9:41598953-41598975 GCTGTTCTCGTCATAGTGGATGG + Intergenic
1053780417 9:41600892-41600914 GCTGTTCTCATGATAGTGAATGG + Intergenic
1053894511 9:42730124-42730146 GCTGTTCTCATGATAGTGAATGG - Intergenic
1054168097 9:61809110-61809132 GCTGTTCTCGTCATAGTGGATGG + Intergenic
1054168359 9:61811049-61811071 GCTGTTCTCATGATAGTGAATGG + Intergenic
1054210778 9:62285373-62285395 GCTGTTCTCATAATAGTGAATGG - Intergenic
1054211042 9:62287279-62287301 GCTGTTCCCATGATAGTGAATGG - Intergenic
1054313940 9:63561572-63561594 GCTGTTCCCGTGATAGTGACTGG + Intergenic
1054669170 9:67769769-67769791 GCTGTTCTCATGATAGTGAATGG - Intergenic
1054669433 9:67771708-67771730 GCTGTTCTCGTCATAGTGGATGG - Intergenic
1055025310 9:71713232-71713254 GCTGTTCTCATGACAGTGAATGG + Intronic
1055083307 9:72289555-72289577 GCTGTTCTTGTGATAATGAATGG - Intergenic
1055083630 9:72291827-72291849 GCTGTTCTCATGATAGTGAATGG - Intergenic
1055525815 9:77132699-77132721 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1056083313 9:83119776-83119798 GCTGTTCTTATGATAGTGAATGG + Intergenic
1056103167 9:83319723-83319745 GCTGTTCTCTTGATAGTGAATGG + Intronic
1056292097 9:85154099-85154121 TCTGTTCTAGTAACAGAGAATGG - Intergenic
1056297564 9:85207751-85207773 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1056475904 9:86950699-86950721 GCTGTTTTCATGACAGTGAATGG - Intergenic
1057425902 9:94949423-94949445 TCTGTCCTCCTGAGAGTGAAAGG - Intronic
1058071341 9:100603427-100603449 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1058082093 9:100711619-100711641 GCTGTCCTTGTGATAGTGAATGG - Intergenic
1058082376 9:100713582-100713604 GCTGTTCTCGTGAGAGTGAGTGG - Intergenic
1058274703 9:103024924-103024946 GCTGTTCTCATGACAGTGAATGG + Intergenic
1058309868 9:103486366-103486388 CCTGTTCTCGTGATAGTGAGTGG + Intergenic
1058764625 9:108169370-108169392 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1058924170 9:109645305-109645327 GCTGGTCTCATGATAGTGAATGG - Intronic
1059040837 9:110814016-110814038 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1059100029 9:111461935-111461957 GCTGTTCTCGTGATAGCGAGTGG - Intronic
1059235321 9:112755810-112755832 CTTGTTCTCATGCCAGTGAAGGG + Intronic
1059474660 9:114535491-114535513 GCTGTTCTCCTGACAGTGAGTGG - Intergenic
1059559514 9:115319574-115319596 GCTGTTCTTGTGATAGTGAATGG + Intronic
1059562570 9:115349213-115349235 GCTGTTCTCATGATAGTGAGTGG - Intronic
1060706925 9:125811441-125811463 CCTGTTCTCATGATAGTGAATGG + Intronic
1061406875 9:130397279-130397301 GCTGATCTCGTGATAGTGAATGG - Intronic
1061961155 9:133990062-133990084 ACTGTTCTCATGACAGAGATGGG + Intronic
1062251486 9:135597868-135597890 GCTGATCTCCTGACAGTGAATGG + Intergenic
1062301071 9:135870234-135870256 GCTGTTCTTGTGATAGTGAGTGG + Intronic
1203617593 Un_KI270749v1:82281-82303 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1185918971 X:4067864-4067886 GCTGTTCTCATGATAGTGAGGGG + Intergenic
1186017566 X:5214848-5214870 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1186165729 X:6824155-6824177 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1186227772 X:7419922-7419944 CCTGTTCAGGTTTCAGTGAAAGG - Intergenic
1186251223 X:7668981-7669003 GCTGTTCTGTTGATAGTGAATGG - Intergenic
1187030286 X:15480102-15480124 GCTGTTCTTGTGACAGTGAATGG + Intronic
1187196492 X:17090403-17090425 GGTGTTCTCGTGATAGTGAATGG - Intronic
1187423157 X:19154169-19154191 GCTGTTCTCATGATAGTCAATGG + Intergenic
1188029764 X:25251329-25251351 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1188297900 X:28472325-28472347 GCTGTTCTCGTGATAATGAATGG - Intergenic
1188397776 X:29706119-29706141 GCTGTTCTCGTGATACTGAATGG - Intronic
1188513517 X:30961246-30961268 GCTGTTCTCGTGATAGTGAGGGG + Intronic
1188631307 X:32364969-32364991 CTTTTTCTCGTGACAGAGAAGGG + Intronic
1188719371 X:33504484-33504506 CCTGTTCTTGTGATAATGAGTGG + Intergenic
1188912528 X:35866912-35866934 GCTGTTCTCTTGATAGTGAATGG + Intergenic
1189071156 X:37865793-37865815 GCTGTTCTCATGACAGTGAGTGG - Intronic
1189537819 X:41954871-41954893 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1189707530 X:43773680-43773702 GCTGTTCTGGTGATAATGAATGG + Intronic
1189945175 X:46170674-46170696 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1189945456 X:46172631-46172653 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1190735009 X:53250410-53250432 CCTCTTCTCGGGACAGTCTAAGG - Exonic
1191736515 X:64394179-64394201 GCTGTTCTTGTGATAGTGAATGG - Intronic
1193452039 X:81683550-81683572 GCTGTTCTCATGATAGTGAATGG + Intergenic
1193519416 X:82510994-82511016 GCTGTTTTCATGATAGTGAATGG - Intergenic
1193625381 X:83813856-83813878 GCTGTTCTCGTGGCAGTGAATGG + Intergenic
1193917503 X:87383090-87383112 GCTGTTCTCATGATAGTGAATGG + Intergenic
1194018193 X:88652491-88652513 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1194036265 X:88876098-88876120 GCTCTTCTGGTGATAGTGAATGG + Intergenic
1194081740 X:89475519-89475541 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1194216115 X:91132443-91132465 GCCGTTCTCGTGATAGTGAATGG + Intergenic
1194216516 X:91135608-91135630 GCTGTTCTTGTGATAGTGAGTGG + Intergenic
1194269614 X:91794886-91794908 GCTGTTCTCATGATAGTGAATGG + Intronic
1194283677 X:91983638-91983660 ACTGTTCTCCTGACAGTGAATGG - Intronic
1194518965 X:94894826-94894848 GCTGGTCTCGTGATAGTGAATGG + Intergenic
1194662253 X:96640024-96640046 CCTGTTCTCATGATAGTGAATGG + Intergenic
1194961677 X:100243449-100243471 GCTATTCTCGTAACAGTGAATGG - Intergenic
1195558479 X:106255257-106255279 GCTGTTCTCGTGGTAGTGAATGG - Intergenic
1195560565 X:106277640-106277662 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1195561397 X:106288699-106288721 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1195670929 X:107469381-107469403 GCTGTTCTCATGATAGTGAATGG - Intergenic
1195788433 X:108554405-108554427 ACTGTTCTCCTGATAGTGAGTGG - Intronic
1196008188 X:110857397-110857419 GCTGTTCTCATGACAGTGAATGG + Intergenic
1196125329 X:112092711-112092733 ATTGTTCTCATGATAGTGAATGG + Intergenic
1196579526 X:117362368-117362390 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1197040293 X:121928834-121928856 GCTGTTCTTATGACAGTGAGTGG + Intergenic
1197103813 X:122689146-122689168 GCTGTTTTTGTGATAGTGAATGG + Intergenic
1197301843 X:124790137-124790159 GCTGTTCTCATGATAGTGCATGG - Intronic
1197610777 X:128635808-128635830 GCTGTTCTCGTAATAGTGAATGG - Intergenic
1198614302 X:138438599-138438621 GCTGTTCTCATGATAGTTAATGG - Intergenic
1198662930 X:138990649-138990671 GCTGTTCTGGTGATACTGAATGG - Intronic
1198793511 X:140371356-140371378 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1198951824 X:142080665-142080687 GCTGTTCTTGTGATAGCGAATGG - Intergenic
1199100075 X:143789479-143789501 GCTGTTCTCTTGACAGTGAATGG - Intergenic
1199398298 X:147366734-147366756 GCTCTTCTTGTGATAGTGAATGG - Intergenic
1199472388 X:148209428-148209450 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1199491162 X:148402280-148402302 GCTGTTCTCATGACAGTGAATGG - Intergenic
1199868647 X:151876895-151876917 GCTGTCCTCCTGATAGTGAATGG - Intergenic
1199934873 X:152562754-152562776 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1200434408 Y:3131709-3131731 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1200586836 Y:5015867-5015889 GCTGTTCTCATGATAGTGAATGG + Intronic
1200601248 Y:5208202-5208224 ACTGTTCTCCGGACAGTGAATGG - Intronic
1201467017 Y:14293588-14293610 GCTGTTCTCATGATAGTGAATGG - Intergenic
1201923981 Y:19265277-19265299 GCTATTCTCATGATAGTGAATGG - Intergenic
1201924200 Y:19267109-19267131 GCTGTTCTCATGACAGTTAATGG - Intergenic