ID: 962505769

View in Genome Browser
Species Human (GRCh38)
Location 3:136045265-136045287
Sequence CAGCTGTGCTGGGTGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 358}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962505769_962505774 -7 Left 962505769 3:136045265-136045287 CCTTGGCTCACCCAGCACAGCTG 0: 1
1: 1
2: 3
3: 43
4: 358
Right 962505774 3:136045281-136045303 ACAGCTGGTGCTCGACCTCAGGG 0: 1
1: 1
2: 3
3: 23
4: 141
962505769_962505779 27 Left 962505769 3:136045265-136045287 CCTTGGCTCACCCAGCACAGCTG 0: 1
1: 1
2: 3
3: 43
4: 358
Right 962505779 3:136045315-136045337 TAAGCTACAGGCCTGGTCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 144
962505769_962505773 -8 Left 962505769 3:136045265-136045287 CCTTGGCTCACCCAGCACAGCTG 0: 1
1: 1
2: 3
3: 43
4: 358
Right 962505773 3:136045280-136045302 CACAGCTGGTGCTCGACCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 145
962505769_962505776 15 Left 962505769 3:136045265-136045287 CCTTGGCTCACCCAGCACAGCTG 0: 1
1: 1
2: 3
3: 43
4: 358
Right 962505776 3:136045303-136045325 GAGCCAGAGAACTAAGCTACAGG 0: 1
1: 0
2: 2
3: 26
4: 199
962505769_962505778 20 Left 962505769 3:136045265-136045287 CCTTGGCTCACCCAGCACAGCTG 0: 1
1: 1
2: 3
3: 43
4: 358
Right 962505778 3:136045308-136045330 AGAGAACTAAGCTACAGGCCTGG 0: 1
1: 0
2: 5
3: 33
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962505769 Original CRISPR CAGCTGTGCTGGGTGAGCCA AGG (reversed) Intronic
900023714 1:202611-202633 CAGCTGGGCTGAGTGGGCCTGGG + Intergenic
900382975 1:2394352-2394374 CAGTTGTGATGGGAGAGCCAAGG + Intronic
900410379 1:2509986-2510008 CAGCTGGGCAGAGTGGGCCATGG - Intronic
900519980 1:3100776-3100798 CAGCTGTGCTGAGTCAGCCCAGG - Intronic
901043212 1:6378533-6378555 CAGCTGAGCTGTGTGAGGCTGGG - Intronic
901860084 1:12068708-12068730 CAGCTGTTCTGGGTCAGGCATGG + Intronic
902244967 1:15114822-15114844 CACCTGTCTTGGGTGGGCCATGG + Exonic
902713575 1:18256964-18256986 CAACTGAGATGGGTGAGCTATGG - Intronic
903179931 1:21600070-21600092 CACCTGTGCTGAGTGACCCTGGG - Intronic
903749830 1:25614782-25614804 CTGGTGTGCTCTGTGAGCCAGGG - Intergenic
904285212 1:29449607-29449629 CAGCTGACCTGGGGGAGCCCCGG - Intergenic
904312728 1:29639811-29639833 CAGCTGTGTGAGGTGAGGCAGGG - Intergenic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
905009710 1:34739153-34739175 CAGCAGAGCTGGGGGAGACAAGG - Intronic
905892326 1:41525208-41525230 TAGCTGGGCTGGCTGTGCCAAGG - Intronic
906142453 1:43541942-43541964 CAGCATGGCTGGGTGAGCCTGGG - Intronic
906535950 1:46551054-46551076 CTGCTGTTCTGGGTGAGCAGGGG - Exonic
906606328 1:47174907-47174929 CAGCTGGGCTGGGTGAGCCCAGG - Intergenic
907298783 1:53472155-53472177 CTGAGGTGCTGCGTGAGCCAAGG + Intergenic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907679166 1:56547682-56547704 CAGCTGGGCAGGGTGGGGCATGG - Intronic
908760408 1:67506638-67506660 CAGCAGTCCTGGGTGAGGGAAGG - Intergenic
910667102 1:89737515-89737537 AAGCTGCTCTGGGTGAGTCAGGG + Intronic
913959539 1:143327876-143327898 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
913972367 1:143424404-143424426 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
914053898 1:144153449-144153471 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
914066749 1:144250017-144250039 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
914112404 1:144716337-144716359 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
914125248 1:144812916-144812938 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
915047289 1:153028976-153028998 CAGTAGTGCTGGATCAGCCACGG - Intergenic
915580061 1:156808235-156808257 GAGCTGTGCTGAGGGAGCCCTGG + Intronic
917519384 1:175735357-175735379 CAGCTGTGGTGGCTGGGCCCAGG - Intronic
918696293 1:187550593-187550615 CAACTGAGGTGGGTGAGACAAGG - Intergenic
919207697 1:194437896-194437918 CCACTGTGCTGGTTCAGCCAAGG - Intergenic
922196261 1:223363245-223363267 CAGCTGTGGTGGGAGGGCCTGGG - Intronic
922725553 1:227921412-227921434 CAGCTGGGCTGGTCGAGCCCAGG + Exonic
923367078 1:233273310-233273332 CTGCAGTGCTGTGTGAGCCATGG + Intronic
923667764 1:236013998-236014020 CACCTGTACAGGGTGGGCCAAGG - Intronic
924793008 1:247270161-247270183 AGGCTGTGCAGGGTGAGCCCTGG + Intergenic
1063324062 10:5079667-5079689 GAGGTATGCTTGGTGAGCCAAGG - Intronic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1064475312 10:15682131-15682153 GACCTGTGCTGGGGAAGCCAGGG - Intronic
1066416197 10:35223862-35223884 CAGATGTGCTGGCTGAGGGATGG + Intergenic
1067069054 10:43119384-43119406 CAGCAGTGCTGCCTGAGGCAGGG + Intronic
1067176664 10:43954751-43954773 CAGCAGTGATGATTGAGCCAGGG + Intergenic
1069895925 10:71680022-71680044 CAGCTTTGCAGGGTGAGCTCAGG - Intronic
1070572420 10:77650237-77650259 AAGCTCTGTTGGGTGAGCCCTGG + Intergenic
1070589923 10:77794416-77794438 CTCCTGTGCTGGTTGGGCCAAGG - Intronic
1072335670 10:94395807-94395829 CAGCTCTGCTGGGTAGGGCAGGG + Intergenic
1072575877 10:96700132-96700154 CAACTGTGTTTGGTGAGCCACGG - Intronic
1072632071 10:97153368-97153390 CAAATGTGCTGGGTAAGGCATGG - Intronic
1072963972 10:99955515-99955537 CTGCTGTGCTGAGGGAGGCAGGG + Exonic
1073758596 10:106607234-106607256 CAGCAGTGGTGGGTAAGCCAGGG + Exonic
1074776601 10:116771931-116771953 CAGCTGTGCTGTCTCAGCCACGG + Intergenic
1075872016 10:125777989-125778011 CAGCAGTGCAGGGGGTGCCAGGG - Intergenic
1076380827 10:130023589-130023611 CAGGTGTGCTGGCTGGGCCTGGG - Intergenic
1077307491 11:1874628-1874650 GAGGTGGGCTGGATGAGCCAGGG + Intronic
1077867567 11:6235286-6235308 CAGCGGTGTTGGGGGAGCCAGGG - Intronic
1081545733 11:44070351-44070373 CAGCAGTGGAGGGTGAGACATGG + Intronic
1083887655 11:65580747-65580769 CAGCTGTCCTGGGTCAGGTACGG - Intronic
1083926329 11:65809204-65809226 CAGCTGCGCTGGCTGAACCCAGG - Intergenic
1084070240 11:66728684-66728706 AAGCTGTGGTGGGGGACCCAGGG - Intronic
1084503035 11:69546101-69546123 CAGCTGTGCTGGTGGAGCACAGG - Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1085227797 11:74938193-74938215 CAGCAGTGGTCTGTGAGCCAGGG - Intronic
1086061800 11:82707619-82707641 CTGGTGTGCTGGGTGAGTCCTGG + Intergenic
1086813239 11:91336277-91336299 CAGCTCTGATGGGTGTGGCAGGG - Intergenic
1088201462 11:107339779-107339801 CAGCTGTTGTGGGGGGGCCAAGG - Intronic
1088761436 11:112932520-112932542 CAGCTGTGATGAGTTCGCCAAGG - Intergenic
1088945196 11:114504525-114504547 CCACTGTGCTGGGGGTGCCAGGG - Intergenic
1089640129 11:119842692-119842714 CTGCTGTGGTGTGTGAGCTAAGG - Intergenic
1089932562 11:122328795-122328817 CAGATGTCCTGGGAGAGTCAGGG + Intergenic
1091251823 11:134150503-134150525 GAGCTGTGCTGGATGAAGCAAGG - Exonic
1091377411 12:34143-34165 CAGCTGGGCTGAGTGGGCCTGGG + Intergenic
1091774917 12:3178248-3178270 CAGCTGTGGCCGGTGACCCATGG + Intronic
1092167970 12:6354684-6354706 CAGCTTTGCAGGGCCAGCCAGGG + Intronic
1092194602 12:6541640-6541662 CAGCTGTGGTGGGGCAGGCAGGG + Exonic
1092731648 12:11540380-11540402 CAGCTGGGCTGAGTGGGCCTGGG - Intergenic
1093267005 12:17015724-17015746 CAGCTCTGATGGGTGTGGCAGGG + Intergenic
1093647456 12:21603831-21603853 CATCTGTGCTGGGTAAGAGAAGG - Intronic
1094064222 12:26346330-26346352 CAGCTGCGCTGGGCCAGGCACGG + Intronic
1094500676 12:31018280-31018302 CAGCTGGGCTGAGTGGGCCTAGG + Intergenic
1096079909 12:48826442-48826464 CAGCTGTGCTGGGTGGTTGATGG - Exonic
1096109021 12:49018361-49018383 CGGCTTTGCTGGGTGAGGCACGG - Intronic
1097186236 12:57198023-57198045 CAGCTCTGGTGGGAGAACCATGG - Intronic
1099890087 12:88580078-88580100 GAGCCGAGCCGGGTGAGCCAGGG - Intronic
1100089759 12:90954968-90954990 CAGGTGTGCTGGGTGGGACTGGG + Exonic
1100841348 12:98615005-98615027 GAGCTTTGCTAGGTGAGACAAGG + Intronic
1100979589 12:100153989-100154011 CAGCAGTGGTGGGAGGGCCAGGG - Intergenic
1101714256 12:107296739-107296761 CAGCTGTTCTGGGTGTGGCTGGG + Intergenic
1101907384 12:108837844-108837866 AGGCTGTGCTGCGTGAGCCGTGG - Intronic
1104878120 12:132050908-132050930 CAGATGTGATGAGTGTGCCAGGG + Intronic
1104919989 12:132285691-132285713 CGCCTCTGCTGCGTGAGCCATGG + Intronic
1105501917 13:20980329-20980351 CAGCTGTGCTGGGTCAGGGCTGG + Intronic
1106789127 13:33136903-33136925 CAGCAGGGCTGGGTCAGCCAGGG + Intronic
1106999473 13:35526785-35526807 CAGGTGTGCTGGCTGTGGCAGGG + Intronic
1107531390 13:41285433-41285455 AAGCCATGCTGGGTGATCCAGGG - Intergenic
1107776708 13:43851745-43851767 CCACTGTGCTGGGGGTGCCAAGG - Intronic
1107828538 13:44352900-44352922 CAGGGGTGGTGGGTGGGCCAGGG - Intergenic
1109202529 13:59446711-59446733 GAGCTGTTCTGGGTGGGCTAAGG - Intergenic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1111267332 13:85834197-85834219 CAGCTGTGGTGGGGGAGGGAGGG + Intergenic
1111531417 13:89541915-89541937 GAGCTGGGCTGGGAGAGACAAGG - Intergenic
1112033207 13:95475498-95475520 CAGCTGTGCTGACTGAGCACTGG + Intronic
1112977442 13:105338387-105338409 CATCTGTGCTGGATGTGCAAGGG - Intergenic
1113728404 13:112622711-112622733 CTGGTATACTGGGTGAGCCAAGG + Intergenic
1115868819 14:37777980-37778002 CTGCTGTGCTGGAGGGGCCAAGG + Intronic
1116393706 14:44422949-44422971 CCCCTCTGCTGTGTGAGCCAAGG - Intergenic
1116437606 14:44912332-44912354 CTGCCGTGCTGGGGGAGCCGGGG - Intergenic
1117267387 14:54104016-54104038 CAGCTGTCCAGGGTGATCCTGGG - Intergenic
1117471470 14:56050579-56050601 CAGCTGTGATGAGGGAGCCTCGG + Intergenic
1121016684 14:90553196-90553218 CAGCTGTTCCGGGTGAGCAGAGG - Intronic
1121552441 14:94812861-94812883 CAGATGTGCAGGTGGAGCCAGGG + Intergenic
1121569326 14:94935783-94935805 CAGCTTTGCTGTGTGTGTCAGGG + Intergenic
1122283824 14:100639313-100639335 CAGCAGTGCTAGGAGAGACAGGG + Intergenic
1122570073 14:102691347-102691369 AACCTGTGCTGAGTGAGTCATGG + Intronic
1122881039 14:104690490-104690512 CAGCTGAGCTGCGGGAGCCCTGG - Intronic
1122959998 14:105089931-105089953 GGGCTGGGATGGGTGAGCCAGGG + Intergenic
1122970134 14:105149152-105149174 CAGAGGTGCTGGGTGCGGCATGG - Exonic
1123084203 14:105709996-105710018 GAGCTGAGCTGGGTGAGCTTAGG - Intergenic
1123423343 15:20148627-20148649 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
1123532564 15:21155148-21155170 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
1124236487 15:27993574-27993596 CAGCTGTCCTGAGAGGGCCATGG - Intronic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1127966053 15:63923675-63923697 CAGCCCTGCTGCGTGAGCCCTGG - Intronic
1128144786 15:65327062-65327084 CTGCGGTGCTGGGTGGGCCAGGG - Intergenic
1128293232 15:66495639-66495661 CAGGTGTTCTGGCTGAGTCATGG + Intronic
1128555514 15:68629076-68629098 AAGGTCTGCTGGGGGAGCCATGG + Intronic
1128737541 15:70061729-70061751 CAGCTGCCCTGGGTCAGCCCTGG + Intronic
1129270398 15:74416564-74416586 CAGTTGTGCAGGGTGAGCAGGGG - Exonic
1131097817 15:89667059-89667081 CAGCTGTGCTGGGCATGGCAGGG - Exonic
1131872995 15:96779892-96779914 CAGCTGTGCCCGGTCAGGCAGGG + Intergenic
1132591068 16:726742-726764 TAGCAGTGCTGGCTGAGCCCCGG + Intronic
1132647392 16:1005238-1005260 CAGCTGGGCTAGGTGAACCTGGG - Intergenic
1133822343 16:9247778-9247800 CAGCTGTACTGGGTGGGACCAGG - Intergenic
1135672659 16:24388513-24388535 CAGCTGTGAGGGGTGATCCACGG - Intergenic
1136286550 16:29247531-29247553 TAGCTGTTCTCAGTGAGCCATGG + Intergenic
1136295857 16:29301688-29301710 CACTTGGGCTGTGTGAGCCAGGG - Intergenic
1136861474 16:33706974-33706996 GAGGTGGGCTGGATGAGCCAGGG - Intergenic
1137636656 16:49992833-49992855 CTGCTGAGCTGTGTGACCCAGGG - Intergenic
1139047330 16:63077518-63077540 CAGCTTTGCTTGGTGAGTCCAGG - Intergenic
1139372438 16:66477425-66477447 CAGCTGTGCTTGGTGAGGAGAGG + Intronic
1139386202 16:66573043-66573065 CAGCTGTGAAGGGTGTGCCAGGG + Intronic
1139633709 16:68245542-68245564 CAGTGGTGCTGGGTGAGGCACGG + Exonic
1141471235 16:84240005-84240027 CAGCTGTCCTGGTTGAGCAGCGG + Intergenic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1141662923 16:85451358-85451380 CTCCTGTGCTGAGTGTGCCAGGG + Intergenic
1141763562 16:86044488-86044510 CAGCAGTGGTGGGTGAGAAAGGG - Intergenic
1141791770 16:86241806-86241828 CCGCTGTGCTCCGGGAGCCAGGG + Intergenic
1142101776 16:88275875-88275897 CACTTGGGCTGTGTGAGCCAGGG - Intergenic
1142126545 16:88413438-88413460 CATCTGTGCTGGGAAAGCCACGG - Intergenic
1142225774 16:88877002-88877024 CAGGTGGGCTGGGGGAGCCGGGG + Exonic
1142259076 16:89034003-89034025 CCCGTGTGCTGTGTGAGCCAGGG - Intergenic
1142361688 16:89630602-89630624 GAGCGGGGCTGGGGGAGCCAGGG + Intronic
1203122973 16_KI270728v1_random:1555165-1555187 GAGGTGGGCTGGATGAGCCAGGG - Intergenic
1142528820 17:564898-564920 CAGCTGTGCTGTGTGAAGAATGG + Intronic
1144163184 17:12581683-12581705 TATCTGTGCTGGCTGAGCCTGGG - Intergenic
1147118747 17:38322448-38322470 AAGCTCTTCTGGGTCAGCCATGG + Intronic
1147256166 17:39183767-39183789 CAGCTGGGCTGGGTGATTGATGG + Exonic
1151323225 17:73363982-73364004 CAGCAGTTCTCGGTGAGCCTAGG - Intronic
1151443975 17:74151347-74151369 CACCTGGGCTGGGTGAAACAGGG + Intergenic
1151522440 17:74640056-74640078 CAGCTGTGCAGGGTGGGTCTCGG - Intergenic
1151669843 17:75566007-75566029 CAGCAGTGCTGGTTTAGACAAGG + Intronic
1152532181 17:80925105-80925127 GAGCTGTGCTGGGTCGGCCCTGG + Intronic
1153454256 18:5262458-5262480 CCACTGTGCTGGGAGGGCCAAGG - Intergenic
1153872528 18:9334465-9334487 CAGCTGGGGTGGGTGCGCCTGGG + Intergenic
1154356619 18:13626711-13626733 CAGCTGTGCTGGGTGGGGCCTGG - Intronic
1155273204 18:24160848-24160870 CAGCTTTGCAGGGTGCGCCCAGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156482939 18:37447589-37447611 AGGATGTGCTGGGTGGGCCAGGG - Intronic
1159803440 18:72927300-72927322 AAGGTGTGCTGTGGGAGCCATGG - Intergenic
1160044544 18:75374731-75374753 TAAGTGTGCTGGCTGAGCCAAGG - Intergenic
1160970379 19:1765277-1765299 CAGCAGTGCTGGGGGCGGCACGG - Intronic
1161105501 19:2441786-2441808 GAGCAGTGCTGGAGGAGCCAGGG + Intronic
1161377200 19:3946079-3946101 CAGCTCTGCTGGGTGACCTTGGG - Intergenic
1161398744 19:4058550-4058572 GAGCTGTGCTGGGTGACTCGGGG - Intronic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162040533 19:7968492-7968514 CAGCTCTGCTGTATGAGCCTGGG - Intronic
1162283503 19:9719572-9719594 CAGGTGTGCTGGGAAATCCAGGG - Intergenic
1163127981 19:15254671-15254693 CAGCTGTGCTGAGAGACCCCCGG - Intronic
1165230604 19:34384185-34384207 CAGCTCTGGTGGGTGAGCCTGGG + Intronic
1166723012 19:45008453-45008475 CATCTGTGCTGGATGAACCTGGG - Intronic
1167440806 19:49507746-49507768 TAGCTGTCCTGGGGGAGCCCAGG + Intronic
1167791630 19:51687009-51687031 CAGGTGTGGTGGCTCAGCCAAGG + Intergenic
1202693372 1_KI270712v1_random:106107-106129 AAGGTGGGCTGGATGAGCCAGGG + Intergenic
925021681 2:574741-574763 CAGCAGTGCAAGGTGAGGCACGG + Intergenic
925835007 2:7935982-7936004 CAGCTGTGCCAGCTGAGCCCTGG + Intergenic
926010311 2:9401385-9401407 CAGGAGTGGTGGGTGAGTCAAGG + Exonic
926160559 2:10486529-10486551 AGGCTGTGCTGGGAGAGCCCTGG - Intergenic
927156388 2:20223938-20223960 CAGCTGCACTGGGCGGGCCAAGG + Intronic
927495288 2:23547834-23547856 CAGCAGTGCTGGATGAGGCCAGG + Intronic
928263220 2:29786591-29786613 GTACTGTGCTGGGTGAGGCAAGG + Intronic
928370026 2:30733929-30733951 CAGAAGTGCTTGGTGAACCATGG + Intronic
929138014 2:38643257-38643279 CAGCACTGCTGGGGGACCCAGGG + Intergenic
929191574 2:39145340-39145362 CAGCTGTGATGGAAGAGCCAAGG - Intergenic
929764897 2:44836296-44836318 AACCTGGGCTGGGTGAGTCATGG - Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931401361 2:61934249-61934271 CAGCTGTCCTGGAAGGGCCATGG + Intronic
932010861 2:67976213-67976235 CACCTGTGATGGGAGAGTCAAGG - Intergenic
932104965 2:68933777-68933799 CAGCAGCGCTGGGTGGGCCCAGG + Intergenic
933547294 2:83730563-83730585 TAGCTGTGCTCCGTAAGCCAGGG + Intergenic
933678631 2:85079171-85079193 CAGCTGTGATGGGAGCGCCTGGG + Intergenic
933725314 2:85423688-85423710 CAGCTGTGATGGGTGATGAAGGG - Intronic
934177060 2:89585342-89585364 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
934237427 2:90244797-90244819 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
934287367 2:91659701-91659723 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
934459854 2:94208103-94208125 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
934718469 2:96556713-96556735 CTGCTGTGCTGGGTGACGCCAGG + Intergenic
935273896 2:101459734-101459756 ATGCTGTGCTGGGAGAACCACGG + Intronic
935854047 2:107255969-107255991 CAGGTGGGCCGGGTGGGCCACGG + Intergenic
936042433 2:109160235-109160257 CTGCTGAGCAGGGTGACCCATGG + Intronic
936239817 2:110777719-110777741 CAGCCCTCCTGGGTGAGCCGGGG + Intronic
936493252 2:112994216-112994238 CACATGTGCTGGGTAAGGCAGGG - Intergenic
936565736 2:113581350-113581372 CAGCTGGGCTGAGTGGGCCTGGG - Intergenic
937246910 2:120499502-120499524 CAGCTGTGCTGGTCCTGCCAAGG - Intergenic
938065789 2:128281276-128281298 CAGCTCCCCTGGGTGAACCAAGG - Intronic
943049104 2:182894244-182894266 CAGCTGGACTAGGTGTGCCATGG - Intergenic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
946439376 2:219682090-219682112 GAGCTTTGCTCGGTGAGTCATGG - Intergenic
947715250 2:232335963-232335985 CTGCAGTGCTGGGGGAGCCCAGG - Intronic
948856099 2:240731399-240731421 CAGCGCTGCTGGTGGAGCCAGGG - Intronic
1168789905 20:568952-568974 CAGCTCTGCTGTGTGAGCCCGGG + Intergenic
1169234328 20:3917461-3917483 CTGCTGAGGTGGGGGAGCCAAGG - Intronic
1169849518 20:10034805-10034827 TAGCTGCGCTGGGTGTTCCAGGG - Intronic
1171492341 20:25529971-25529993 CTGGTGGGCTGGGTGAGCCCTGG - Intronic
1172010293 20:31842512-31842534 CGGCTGGGCTGGGGGAGCCCAGG - Intergenic
1172054212 20:32142893-32142915 CAGGCATGCTGGGTGAGGCAAGG + Intronic
1172191348 20:33063664-33063686 GGGCTGTGCTGGGTAAGTCAGGG + Exonic
1172293265 20:33791085-33791107 CCGCTGTGCTGGCTGCGCCAAGG + Exonic
1172324404 20:34023385-34023407 CAGTTTTGGTGGGAGAGCCATGG + Intronic
1172330447 20:34072283-34072305 CAGCTGTGCTGGGAGAGAATGGG + Exonic
1173640028 20:44595081-44595103 CAGCTGTGCTGGGAGAGTTGAGG + Intronic
1174382270 20:50163718-50163740 CAGCTGTGCTGGCTGGGCTAAGG + Intergenic
1174489288 20:50880885-50880907 CAGGTGTGCTGAGTGAGGTATGG - Intronic
1175049177 20:56137374-56137396 CAGGTGTTCTGGATGAACCAGGG - Intergenic
1175222537 20:57425669-57425691 CAGCTGTGCTGGGGGAGGGGAGG - Intergenic
1175401931 20:58705743-58705765 CAGCTGTGACGGGGGAGACATGG + Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1175948443 20:62569685-62569707 CAGGCGTGGTGGGTGACCCACGG - Intronic
1176237164 20:64058798-64058820 CATCTGTGCCGGGTCAGCCACGG + Intronic
1178690113 21:34743458-34743480 CTGCTGTCCAGGGTCAGCCACGG + Intergenic
1178830708 21:36054182-36054204 CAGCTGTTCCCTGTGAGCCAAGG + Intronic
1179066011 21:38025550-38025572 CAGTTCTGCTGGGGAAGCCATGG - Intronic
1179177527 21:39019818-39019840 TTGTTGTCCTGGGTGAGCCAGGG - Intergenic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179953926 21:44727459-44727481 CAGCTGTGCTGGGTGCAGCAAGG - Intergenic
1180181371 21:46120050-46120072 CAGCTGTGCGGGGTGTGCCTGGG - Intronic
1181985580 22:26798044-26798066 CAGCTGGGCTGGGTGACCTTGGG + Intergenic
1182654153 22:31876577-31876599 CACCTGGGCTGGGTGGGCAAGGG - Intronic
1183293052 22:37014603-37014625 CAGCATTGCTGGGGGAGCCCAGG + Intronic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1184001101 22:41674251-41674273 CAGCCTGGGTGGGTGAGCCATGG - Exonic
1184326264 22:43789350-43789372 CAGCAGCACTGGGTGAGCCAAGG + Intronic
1184687365 22:46102680-46102702 CTTCTGTGTTGGGTGAGCCCAGG - Intronic
1184757765 22:46526549-46526571 GAGATGTGATGGGTTAGCCAAGG - Intronic
1184877449 22:47284505-47284527 CAGCCGAGGTGGGTGAGCCCTGG - Intergenic
1185085278 22:48737553-48737575 ACACTGTGCTGGGTGAGCCTGGG + Intronic
1185224289 22:49644127-49644149 CAGCTGAGCTGGGTGGGCAGAGG - Intronic
1185305396 22:50112617-50112639 CTGCTGGGGTGGGTGAGCCAGGG + Intronic
1185309863 22:50148285-50148307 CTGCTGGGGTGGGCGAGCCAGGG + Intronic
949874782 3:8619033-8619055 CAGCTGTGTTGGATGGACCAAGG - Intergenic
949996251 3:9619661-9619683 AAGCAGTGCTGGGTCAGCCCAGG + Intergenic
950002785 3:9669850-9669872 CAGCTGTACTGGGTGAGATCTGG - Intronic
950667425 3:14505857-14505879 CAGCTGTGCTGAGTGACCCTGGG + Intronic
953885104 3:46710551-46710573 CAGCTGTGCTGGGAGGTCCCAGG + Exonic
954861405 3:53694106-53694128 CAGTAGTGTTGGCTGAGCCAGGG + Intronic
956685663 3:71825172-71825194 CATCTCTGCTGGGTCACCCAGGG - Intergenic
956791465 3:72683402-72683424 CAGCTGTGATGTGTAAGCCCTGG + Intergenic
958729043 3:97940793-97940815 CAGCTGTGCTGAGGGAGGTAGGG - Intronic
960379324 3:116939982-116940004 CAGCTCTGATGGGGGTGCCAGGG - Intronic
961650243 3:128413519-128413541 CTGCTGGCCTGGGTGGGCCAGGG - Intergenic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
962813082 3:138975311-138975333 CAGCTCTGCTGGGGAAGCCAGGG + Intergenic
963409797 3:144912702-144912724 CAGCTCTGCTGGTAGAGCCTGGG - Intergenic
966320740 3:178698978-178699000 CCACTGTGCTGGGAGGGCCAAGG + Intronic
967147302 3:186617110-186617132 CAGCTCTGCTGCGTTAGCAAGGG - Intronic
968460943 4:724405-724427 CAGCGGTGCTGTGGGGGCCATGG + Intronic
968520420 4:1032510-1032532 CAGATGTGGTGGGAGAGCGAGGG + Intergenic
968552697 4:1231847-1231869 CAGCCGTGCTGAGGGAGCCTGGG - Intronic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968983440 4:3863146-3863168 CAGCCCTGCAGGGTGGGCCAAGG - Intergenic
969116396 4:4872986-4873008 CAGCCGGGCTGGGGGAGGCAGGG + Intergenic
969249574 4:5958148-5958170 CATCTCTGGTGGGTGAGCCTGGG + Exonic
969526785 4:7707892-7707914 GAGCTGTGCTGGCTGGGCCCTGG - Intronic
970224775 4:13846350-13846372 CAGCATTGCTGGGGGAGGCAAGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
970890371 4:21037306-21037328 AAGTTGTTTTGGGTGAGCCAGGG - Intronic
971349595 4:25844083-25844105 CATCAGTGCTGGCTGAGACAGGG + Intronic
972218475 4:36924206-36924228 CAGTTGTGGTGGGTGGGCCTTGG - Intergenic
974856300 4:67465700-67465722 CAGCTGTGGTGGGGGTGGCAGGG - Intergenic
975392847 4:73839280-73839302 AAGCTTTGCTGAGTGTGCCAAGG - Intronic
975843387 4:78500259-78500281 GTGCTGTGCTGGGTCAGTCAAGG + Intronic
976002202 4:80386607-80386629 CCGCTATGCTGGCTGTGCCAAGG - Intronic
976403092 4:84629963-84629985 AGGCTGTGCTGGGAGAGTCAAGG + Intronic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
978139947 4:105307050-105307072 AAGCTGGGCTGGGACAGCCAAGG + Intergenic
978809093 4:112830971-112830993 CAGCAGTGCTGGGGGACCCGGGG - Intronic
979819891 4:125158150-125158172 CAGCTTTGCAGGGTGATCCTAGG - Intergenic
980098660 4:128519633-128519655 CAGCTCTGCTGGTGGTGCCAGGG + Intergenic
983539173 4:168890174-168890196 GACCTGAGCTGTGTGAGCCAAGG - Intronic
985276671 4:188244382-188244404 CCGCTGTGCTGAGTGAGATAAGG - Intergenic
985551606 5:535961-535983 CACCTGGGCAGGGCGAGCCAGGG + Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
986307696 5:6528021-6528043 GAACTGTGCTGGGTGAGCCATGG + Intergenic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
988263812 5:28926515-28926537 GAGGTGGGCTGGATGAGCCAGGG + Intergenic
989791507 5:45408278-45408300 AAGCTGCTCTGGGTGAGTCAGGG - Intronic
992609688 5:78496560-78496582 GAGCTGTGCTGGGTCAACAAGGG - Intronic
993711000 5:91225120-91225142 CAGATGTGCTGATTGAGTCAAGG - Intergenic
994753348 5:103764887-103764909 CAGCTGTAGTGGGGGAGGCATGG - Intergenic
995751003 5:115453255-115453277 CAGCTCTGCTGGTAGAGGCAGGG + Intergenic
996954151 5:129163680-129163702 CCACTGGGCTGGGTGGGCCAGGG + Intergenic
997408164 5:133669153-133669175 CAGCTGTAGTGGGTGAGCTCAGG - Intergenic
998104964 5:139462627-139462649 CAGCTGTGCTGGGTGATCCTGGG - Exonic
998181490 5:139948778-139948800 CAGGAGTTCTGGGTGAGACAAGG + Intronic
999202540 5:149826515-149826537 CAGCTCTGCTGGGTGGGCAGAGG + Intronic
999303863 5:150507602-150507624 CAGCTGAGCTGGGTGGGGCCAGG + Intronic
1001886364 5:175293935-175293957 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1002132795 5:177091797-177091819 TAGATGTGCTGGGTGAGCGCGGG + Exonic
1002256154 5:177959676-177959698 CAGCGGTGATGGGGCAGCCATGG - Intergenic
1003147072 6:3517677-3517699 CAGGTGCTCTGGGTAAGCCAGGG - Intergenic
1003220092 6:4153492-4153514 CAGCAGTGCTGGGAGAGAGAGGG + Intergenic
1003643486 6:7895337-7895359 CTGCTGTGCTGAGTGAGGCCAGG + Intronic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1008379202 6:50823449-50823471 CAGCTGGGCTCGGTGTCCCAAGG + Exonic
1009307110 6:62103710-62103732 CAGCTGTAGTGGGAGAGACATGG - Intronic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1013271151 6:108546628-108546650 CAAATGTGTTGGGTGAGCCAAGG + Intergenic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1015077471 6:129177752-129177774 GAGCTGTGATCGGTGTGCCAGGG + Exonic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1017872885 6:158502013-158502035 CAGCTGTCCACGGTGGGCCATGG + Exonic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018276886 6:162142269-162142291 CATCTGTGCTGCATGAGCCAGGG - Intronic
1019316998 7:391434-391456 GAGCTGGCCTGGGTGAGCCCGGG - Intergenic
1019355249 7:575263-575285 CGGCTGTGCTGGCTGAGGCTGGG + Intronic
1019488254 7:1299281-1299303 CAGCTGAGCTGGGGGTGCCCTGG + Intergenic
1021934202 7:25614200-25614222 CAGCTTGCCTGTGTGAGCCAGGG + Intergenic
1022330129 7:29370821-29370843 CTGCAGAGCTGGGTGAGTCAAGG + Intronic
1023174240 7:37420248-37420270 CATCTTTGCTAGGTGACCCATGG - Intronic
1023720211 7:43085238-43085260 AAGCTGTGCAGGGAGAGCCCTGG + Intergenic
1025263866 7:57439990-57440012 GAGCTGAGCTGGGGGAGTCAGGG - Intergenic
1025635367 7:63316119-63316141 GAGCTGAGCTGGGGGAGTCAGGG + Intergenic
1025647327 7:63432051-63432073 GAGCTGAGCTGGGGGAGTCAGGG - Intergenic
1026489130 7:70847720-70847742 CAGGTGTGCTGGGAGCTCCAGGG - Intergenic
1027361372 7:77414066-77414088 GAGCTGGGCTGAGTCAGCCATGG - Intronic
1027878477 7:83801683-83801705 CAGCTGTGCAGGAATAGCCATGG + Intergenic
1028857961 7:95613295-95613317 CCACTGTACTGGGGGAGCCAAGG - Intergenic
1032697151 7:134347160-134347182 CAAGGATGCTGGGTGAGCCAGGG + Intergenic
1032697794 7:134352417-134352439 CAAGGATGCTGGGTGAGCCAGGG + Intergenic
1033184893 7:139218372-139218394 CAGCTGTGCTTGTTTAGCCTTGG - Intergenic
1033185236 7:139221121-139221143 CAGCTGTGCTTGTTTAGCCTTGG - Intergenic
1034392287 7:150796097-150796119 GAGCTCTGATGGGTGAGCGATGG - Intronic
1034856431 7:154552553-154552575 AAGCTGTGCTGGATGGTCCATGG + Intronic
1035646118 8:1222446-1222468 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1036086195 8:5615835-5615857 CAGCTGTCCTGGCCGTGCCAAGG + Intergenic
1038610768 8:29058435-29058457 CACTTGTGCTGGGTGAGCCCAGG + Intronic
1040404387 8:47086069-47086091 CAGCTGGGGTGGGGGGGCCAGGG + Intergenic
1041094769 8:54339070-54339092 CGACTGGGCTAGGTGAGCCACGG - Intergenic
1041510745 8:58652512-58652534 GAGCTGGGATGAGTGAGCCAAGG + Intronic
1041632431 8:60103250-60103272 CAGCTGGCCTGGGTGAGGCAGGG - Intergenic
1042790919 8:72605226-72605248 CAGCTGTGCTGTGTCAGGCTTGG - Intronic
1045287469 8:100804380-100804402 CAGCTGTGCATGGTGAGAGAAGG + Intergenic
1047251056 8:123182438-123182460 CAGCTGGGCTGGTGGTGCCAGGG + Exonic
1048825240 8:138417598-138417620 CTGCTGTGTTGGAGGAGCCAAGG - Intronic
1049798165 8:144505808-144505830 CAGCAGTGCTGGGTGAGCCAAGG - Intronic
1050852114 9:10300882-10300904 ACACTGTGCTGGGAGAGCCATGG - Intronic
1053690355 9:40583911-40583933 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
1054301606 9:63384872-63384894 AAGGTGGGCTGGATGAGCCAGGG - Intergenic
1055402678 9:75941277-75941299 CAGCTGTGTGGGCTGATCCAGGG + Intronic
1055487248 9:76768083-76768105 CAGCCGTGCTGGGATGGCCAGGG - Intronic
1056107312 9:83360104-83360126 CAGCTTTGCTGCCTGAGCCGAGG + Intronic
1056572208 9:87825657-87825679 CAGCTGGGCTGTGTGAGCTGGGG - Intergenic
1056734941 9:89201477-89201499 CAACTGTGCTGGTTGGGGCAAGG + Intergenic
1056825524 9:89874008-89874030 CAGGTGAGCTGGGAGAGACAAGG - Intergenic
1057217004 9:93234674-93234696 CAGGTGTTCTGAGTGTGCCATGG + Intronic
1058694505 9:107547996-107548018 AAGCTGTGCAGGGAGAGCTAAGG + Intergenic
1059921797 9:119168120-119168142 CAGCGGAGCTGCGTGTGCCACGG - Exonic
1060654420 9:125359222-125359244 CAGAAATGCTGAGTGAGCCAAGG - Intronic
1061849699 9:133407169-133407191 CAGATGTACTGAGTGAGACATGG + Intronic
1061920397 9:133779385-133779407 GAGCTGGGCTGGGAGAGCCATGG - Intronic
1061937039 9:133863686-133863708 CAGCTATGCTGGAGGAGCCCTGG + Intronic
1062086578 9:134652341-134652363 CGGCTCTGCTGGGTGGGGCAAGG + Intronic
1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG + Intergenic
1062318635 9:135979879-135979901 CGGCTGTGCTGGTTCAGCCATGG - Intergenic
1062328999 9:136028564-136028586 CAGCTGTAGTGGGTGAGGCGTGG + Intronic
1062448641 9:136606348-136606370 CAGCCGTGCTCTGTGGGCCAGGG + Intergenic
1062583998 9:137240859-137240881 CAGCTGCGCTGGGGGCGCCGAGG - Intergenic
1062623721 9:137433853-137433875 CTGCAGTGCAGGGTGAGCCAAGG + Exonic
1187320584 X:18234233-18234255 CAGGACTGCGGGGTGAGCCAGGG + Intergenic
1189431340 X:40950235-40950257 CAGCTGTGTGGGCTGAGCCCTGG - Intergenic
1189482730 X:41405691-41405713 CAGCTGAGCCTGGTGAGCCCAGG - Intergenic
1189926500 X:45960290-45960312 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1191152903 X:57240390-57240412 CTGCTGTGCTGGATGGGCCAAGG + Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193449414 X:81647215-81647237 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1195468623 X:105209514-105209536 CAGCTCTGATGGGTGAGGGAAGG - Intronic
1195683387 X:107565007-107565029 CAGCTGTTCCGGGAGAACCAGGG + Exonic
1196594046 X:117522531-117522553 CAGGTGAGCTGGGGGAGACAGGG - Intergenic
1197719595 X:129736069-129736091 CAGCTTTGCTGTGGGAGCCCCGG - Intergenic
1197814243 X:130480356-130480378 CCCCTGAGGTGGGTGAGCCAGGG - Intergenic
1198217177 X:134566297-134566319 GAGCAGGGCTTGGTGAGCCATGG + Exonic
1200084017 X:153594119-153594141 CAGCTGTGCTTAGGAAGCCATGG - Intronic
1200216507 X:154370488-154370510 CAGCTGTGGGGGGAGAGCCCGGG + Intronic
1201475230 Y:14374580-14374602 CAGTTGTGCAGGGAGAGACATGG + Intergenic
1202198131 Y:22317367-22317389 CAGCTGGACTGCTTGAGCCACGG - Intronic