ID: 962509181

View in Genome Browser
Species Human (GRCh38)
Location 3:136081700-136081722
Sequence TAGGGGAGTACAGTGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962509181 Original CRISPR TAGGGGAGTACAGTGAGTCA GGG Intronic
900665192 1:3810532-3810554 TTGGAGACTGCAGTGAGTCATGG + Intergenic
902975111 1:20082842-20082864 CAGTGGAGTAGAGTCAGTCAAGG + Intronic
904094468 1:27966470-27966492 TAGGAGGGAACAGTGAGTCCTGG - Intronic
905273684 1:36803328-36803350 TAGGGGAGGAGAGTGAGGGAAGG + Intronic
905395277 1:37662645-37662667 TAGGGCAGTGCAGTGAGGGAAGG + Intergenic
907534561 1:55138162-55138184 GAGGGGAGCACAGTGAGAAAGGG - Intronic
907844343 1:58190282-58190304 TGGTGGAGTACAGTCAGTCAGGG - Intronic
910562956 1:88612321-88612343 TTGGGCAGAACAGTGAGACATGG - Intergenic
910857875 1:91714168-91714190 TAGGTGAGTAAACTGAGTCTCGG - Intronic
913007450 1:114648694-114648716 TAGGGAAGTACAGAGACACAGGG + Intronic
917916666 1:179709089-179709111 TGGGGGAGTGCAGTGAATAAGGG - Intergenic
919362952 1:196617643-196617665 GAGGGGATTGCAGTGAGCCAAGG + Intergenic
920284573 1:204870475-204870497 TAGGGGAGCACAGTGTGGCGGGG - Intronic
922396728 1:225209881-225209903 AAGGGAAGTACAATGGGTCAGGG + Intronic
924590470 1:245398857-245398879 TAACGGAGTACAGTGAATAAGGG - Intronic
1062902626 10:1157410-1157432 TAGGGAAGGACAGAGAGACAGGG + Intergenic
1065894950 10:30154978-30155000 TTGGGGATTACAGTGTGACATGG + Intergenic
1071414802 10:85431205-85431227 CATGGGAGCAGAGTGAGTCATGG + Intergenic
1072967031 10:99982612-99982634 TAGGGGAGTACAGGGAACCCAGG - Intronic
1077372910 11:2192048-2192070 GAGGGAAGCACAGTGAGCCAGGG + Intergenic
1077376324 11:2206445-2206467 TAGGGAAGGACAGTGAGTCTGGG + Intergenic
1077572508 11:3352366-3352388 TCGGGGAGCTGAGTGAGTCAGGG + Intronic
1077917068 11:6618336-6618358 TGGGGGAGTACAGTGAGGGGTGG + Intronic
1078022846 11:7669906-7669928 TAGGGTAGCACAGGGAGGCAGGG - Intronic
1078930051 11:15905751-15905773 TTGGGGAGCTTAGTGAGTCAGGG - Intergenic
1081822251 11:46010788-46010810 TAGGGGTGTAGAGTTAGTCAGGG - Intronic
1082011922 11:47455721-47455743 AAGGCGAGAACAGGGAGTCAGGG - Intergenic
1083517616 11:63275043-63275065 GAAGGGTGTACAATGAGTCAAGG - Intronic
1086255821 11:84875083-84875105 TAAGGCAGAAAAGTGAGTCATGG + Intronic
1091651394 12:2312964-2312986 TAGGGAAGGACAGTGGGTGAGGG - Intronic
1093655293 12:21687673-21687695 TAGGGGAGTGTAGTGAGCCTTGG - Intronic
1097730802 12:63126012-63126034 TAGTAGAGTAAAGTGAATCAGGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101471319 12:104999575-104999597 TAGGGGAGCAAGGTGAGTCATGG + Intronic
1108607188 13:52051455-52051477 TAGTGGAGTACAAAGAGTCATGG + Intronic
1109479804 13:62935611-62935633 TTAGGAAGTACAGTGGGTCAGGG - Intergenic
1111012486 13:82329753-82329775 AAGGGGAGAAGAGTGACTCAAGG - Intergenic
1113043508 13:106129047-106129069 TAGGAGAGTACAATAAGTAATGG - Intergenic
1115373514 14:32646832-32646854 AAAAGGAGTACAGTGATTCATGG + Intronic
1117609089 14:57464055-57464077 TAGAGGAGTAAAGTGAGACAGGG - Intergenic
1119407142 14:74405995-74406017 CAGGGGAGGACAGTGGGACAAGG + Exonic
1119769944 14:77214274-77214296 CAGAGGAGTAAAGTGAGGCATGG + Intronic
1119883116 14:78117170-78117192 TATTGCAGTAAAGTGAGTCACGG + Intergenic
1120444704 14:84579465-84579487 CAGGCCAGTAGAGTGAGTCAAGG + Intergenic
1121458178 14:94052750-94052772 CAGTGGAGTACAGTGAGGAAGGG - Intronic
1121822750 14:96984599-96984621 CATGGGAGTTCAGGGAGTCAAGG - Intergenic
1123875766 15:24622261-24622283 TAGGGGAGCACGGTGAGCCTTGG + Intergenic
1124125634 15:26936283-26936305 TAGGGCAGTTCTGGGAGTCAGGG - Intronic
1124230635 15:27943226-27943248 GAGTGGGGTACAGTGAGGCACGG - Intronic
1125279098 15:38025706-38025728 TATGGGAGTACAGTGAGATTGGG - Intergenic
1126345674 15:47691416-47691438 AAGAGGAGTACAGAGACTCAAGG + Intronic
1126694396 15:51313879-51313901 TAGGAAAGCACAGTCAGTCAGGG - Intronic
1127149620 15:56060102-56060124 CAGGTGGGTACAGGGAGTCATGG + Intergenic
1127812757 15:62578798-62578820 CAGGGGAGCAGAGTGAGGCATGG + Intronic
1129797157 15:78386592-78386614 TGGGGGAGTGGAGTGAGACAGGG - Intergenic
1133100858 16:3478758-3478780 TAGGGGAGTGGAGTGATTCCAGG - Intronic
1133377887 16:5304464-5304486 TAGGGGAGTTGAGTCTGTCATGG + Intergenic
1137613614 16:49834847-49834869 CAGGGGACTAAAGTGGGTCAAGG + Intronic
1145358756 17:22191669-22191691 TTAGGAAGTACAGTGGGTCAGGG + Intergenic
1146460203 17:33040186-33040208 TCAGGGAGTGCAGTGAGTGATGG + Intronic
1146629855 17:34462085-34462107 CAGATGAGGACAGTGAGTCATGG - Intergenic
1147143581 17:38472793-38472815 CAGGAGAGGACACTGAGTCATGG - Intronic
1147487246 17:40828379-40828401 TAGGGTAGTAAACTGAGACACGG - Intronic
1150839766 17:68596886-68596908 GAGGGAAGAACAGTGAGTGAAGG + Intronic
1151122468 17:71808292-71808314 TAGAGGAGTATGGTGAGTCTTGG - Intergenic
1152043024 17:77917327-77917349 GAGGGAAGCACAGTGAATCAGGG - Intergenic
1152522608 17:80867526-80867548 CTAGGTAGTACAGTGAGTCAAGG + Intronic
1154042189 18:10866719-10866741 TGGGGGAATAAAGTCAGTCATGG + Intronic
1155450640 18:25959367-25959389 TGGGGGAGTACAGGGAGGGAAGG + Intergenic
1155876439 18:31095776-31095798 TAGGGAAGTACAGGGAGCTATGG + Intronic
1158354722 18:56605294-56605316 GAGGGGAGTAGAGTGAGACAAGG + Intronic
1161412987 19:4127291-4127313 TAGGTGAGTGCAGTGGCTCACGG - Intergenic
1165761908 19:38326569-38326591 TAGGGGAGTAAAGAGAGTAAAGG - Intronic
1165845248 19:38813755-38813777 GAGGAGAGTGCAGTGAGCCAAGG + Intergenic
1167590012 19:50399329-50399351 AAGTGGAGTACATGGAGTCATGG - Intronic
926240487 2:11081171-11081193 GAGGGGGGTACAGGGAGGCATGG - Intergenic
927006700 2:18858032-18858054 TAGGGGAATACAGCAAGTCAGGG - Intergenic
928175059 2:29027886-29027908 TGGTGGAGCACAGTGAGTGAGGG + Intronic
930248082 2:49005186-49005208 TAGGGGAGAACAGGGAGGAAAGG + Intronic
931381579 2:61758343-61758365 GAGGTAAGTACAGTGTGTCATGG - Intergenic
932686757 2:73877104-73877126 TTGGGGAGTAGAGAGAGCCAGGG - Intergenic
936573435 2:113634820-113634842 TATGGGAAGACAGTGGGTCAGGG - Intronic
941617171 2:167733870-167733892 TGGAGGAGGACAGTGTGTCATGG - Intergenic
942987749 2:182162770-182162792 TAGGGGAGTCAGGTGATTCATGG + Intronic
945351328 2:208784454-208784476 TTGGGAAGTACAAAGAGTCAGGG + Intronic
948315737 2:237027065-237027087 TGGGGGAGTGCAGTGTGTCCAGG + Intergenic
1171059491 20:21942640-21942662 TAGGAGAATGGAGTGAGTCATGG - Intergenic
1172846754 20:37934242-37934264 CAGGGGAGTTCAGGGAGTGACGG + Intronic
1174389029 20:50205959-50205981 TTGGAGAGAACAGGGAGTCAGGG + Intergenic
1179170099 21:38966320-38966342 TAGGGGAGAAGAGTGAGACTGGG - Intergenic
1182866347 22:33607648-33607670 TGGAGGAGGACAGTGAGTCTGGG + Intronic
1184951210 22:47843725-47843747 TGGAGGAGTACAGGGAGGCAGGG + Intergenic
1185335419 22:50269105-50269127 TAGGGGACTAGGGTGGGTCATGG - Intronic
1185426747 22:50776060-50776082 TATGGGAAGACAGTGGGTCAGGG + Intronic
949841160 3:8321546-8321568 TAAGGGAGTACAGAGAGAGAGGG - Intergenic
951699358 3:25479190-25479212 TCGTGAAGTACAGTGTGTCAAGG + Intronic
954901597 3:54024994-54025016 CAGAGGAGGACACTGAGTCATGG + Intergenic
955478804 3:59368128-59368150 TAGGGGAATAAATAGAGTCAGGG - Intergenic
955490834 3:59480584-59480606 CAGGGCAGTAGAATGAGTCATGG - Intergenic
956004250 3:64762003-64762025 CAGTGGAGTACAGTGAGCAAAGG + Intergenic
956433581 3:69211359-69211381 TAGTGTAGTACAGTGATGCAGGG - Intronic
957751272 3:84419931-84419953 TAAGAGAATACAATGAGTCAAGG + Intergenic
962509181 3:136081700-136081722 TAGGGGAGTACAGTGAGTCAGGG + Intronic
963900459 3:150727986-150728008 TAGGGGAGAACGCTGAGTCAGGG + Intergenic
965327327 3:167323363-167323385 TAAGGGAGAAAAGTGAATCACGG - Intronic
966744397 3:183262355-183262377 TAGGGGAGTCAGGTGAGGCAGGG + Intronic
969999896 4:11354646-11354668 AAGGGGAGAAGAATGAGTCAAGG - Intergenic
971530209 4:27678326-27678348 TAGGGGAATACCATGAGTTATGG - Intergenic
977612212 4:99047688-99047710 TAGGAGAGTAGAGAGAGTTAAGG + Intronic
980841648 4:138268603-138268625 TAGGGGTTTACAGTGAATGAGGG - Intergenic
981330066 4:143497991-143498013 TAGGAGATTGCAGTGAGCCAAGG + Intergenic
983105192 4:163678137-163678159 TAGGGAAGAACAGAGAATCAAGG - Intronic
986502591 5:8416032-8416054 TAGGGCAGTAAAGTGTCTCAGGG - Intergenic
989716437 5:44468516-44468538 TAGAGGAGCACAGTGAGCCTTGG + Intergenic
991028124 5:62052533-62052555 TAGGGGAGCAAAGTGAGCCTTGG + Intergenic
992452049 5:76884160-76884182 TAGGGCAGTAAAGTGTCTCAGGG + Intronic
994161943 5:96566570-96566592 TAAGTGAATACAGTGGGTCATGG - Intronic
994617825 5:102128259-102128281 TAGGCAAATACAGGGAGTCATGG - Intergenic
1001338346 5:170820717-170820739 GAGGGGAAAACAGTGATTCAAGG + Intergenic
1006574185 6:35031881-35031903 TAGGGGAAAACAGTGAGTATAGG - Intronic
1009355566 6:62740212-62740234 TAGAGGGGTACAGTGAGCCTTGG - Intergenic
1010507538 6:76678734-76678756 TAGCAGAATACAGTGAGCCAAGG - Intergenic
1012708966 6:102573094-102573116 TATGGGAACACAATGAGTCATGG - Intergenic
1012722308 6:102760451-102760473 TAGGAGAGGACAGAGATTCATGG - Intergenic
1012910117 6:105108603-105108625 TAGGGGAAAAAAGAGAGTCAAGG + Intronic
1015276825 6:131390850-131390872 CTGGAGAGTACAGTGAGACATGG + Intergenic
1015337299 6:132054438-132054460 TAGGGGAGGATAATGAATCAGGG - Intergenic
1015984365 6:138870931-138870953 CAGGGGGGTTCAGTGAGCCAAGG + Intronic
1016488619 6:144571412-144571434 AAGGGGACTGCAGTGAGTCGAGG - Intronic
1016511511 6:144848395-144848417 AAAGTGAGTACAGTGATTCAAGG + Intronic
1017046871 6:150355280-150355302 TTAAGGAATACAGTGAGTCAGGG - Intergenic
1017994131 6:159516962-159516984 TCGGGGAATACAGTTAATCAGGG - Intergenic
1018152747 6:160955638-160955660 TAGGGAGGAACAGTGAGTCAAGG + Intergenic
1020040328 7:4996577-4996599 TAGGAGGGAACAGTGAGTCCAGG - Intronic
1020831175 7:13097263-13097285 TAGGGGAGAAAAGTGAGTGTGGG + Intergenic
1022467816 7:30663285-30663307 AAAGTGAGTAAAGTGAGTCAAGG + Intronic
1022522176 7:31015448-31015470 TAGGTGAGAACACTGAGGCATGG - Intergenic
1023279645 7:38556500-38556522 TGCGGGACTACAGTGAGTGAGGG - Intronic
1024058966 7:45684046-45684068 GAGGGAAGTGCAGTGATTCACGG + Intronic
1033642188 7:143272191-143272213 TAGGGAAGTACAGGGAGGGAGGG - Intergenic
1033712072 7:143958010-143958032 GAGAGGAGCACAGTGAGTCATGG + Intergenic
1038351192 8:26777771-26777793 TGGGAGGGTACAGTGAGTAAGGG + Intronic
1041021924 8:53646675-53646697 TAGGGGAGAACCATAAGTCATGG - Intergenic
1041339354 8:56826039-56826061 CAGGCAAGTACAGGGAGTCATGG + Intergenic
1042526023 8:69765872-69765894 TAGGGGAGGACAGTCAGGCCTGG - Intronic
1043603396 8:81969388-81969410 TAGTGGAGCACAGTGAGTGATGG - Intergenic
1044551221 8:93514624-93514646 CAGGGGAGTACAGTGTGATACGG - Intergenic
1047115322 8:121835275-121835297 TAGAGGAATTCATTGAGTCAAGG - Intergenic
1050474125 9:6021934-6021956 TAGGGCTGTACAGTGTCTCAGGG - Intergenic
1051341020 9:16110678-16110700 TAGGGAAGAAAAGGGAGTCAGGG - Intergenic
1052716555 9:32124977-32124999 CTGGGCAGTACAGTGAGACATGG + Intergenic
1054972230 9:71101488-71101510 TAGGAGAGTACAGGGAGTACAGG + Intronic
1057784012 9:98073234-98073256 CTGGGGAGAACAGGGAGTCAGGG - Intronic
1059665493 9:116442615-116442637 CAGGGAAGAACAGAGAGTCATGG + Intronic
1060686484 9:125618410-125618432 TATGGGACTACAATGAATCAAGG + Intronic
1061402518 9:130376151-130376173 GAGGAGAGAACAGTGAGTTAGGG + Intronic
1187044911 X:15637912-15637934 TCAGGAAGCACAGTGAGTCAGGG - Intronic
1188368873 X:29344585-29344607 TTGGAGAGTAGAGTGAGTAATGG - Intronic
1188799185 X:34505969-34505991 TAGAGGAGAAAAGGGAGTCATGG - Intergenic
1189067216 X:37823234-37823256 TAGGAGAGAAAACTGAGTCATGG + Intronic
1190311487 X:49119956-49119978 TGGAGGAGTACAGTGAGGGATGG - Intronic
1190325351 X:49203963-49203985 TAGGTGAGAACAGCAAGTCATGG - Intergenic
1190441010 X:50474248-50474270 TAGGAGACTAGAGTGAGTAAAGG - Intergenic
1190619386 X:52269950-52269972 CAGGGGAGGAAAGTGGGTCATGG + Intergenic
1190797617 X:53759627-53759649 TTGGGGAGAAGAGTGATTCAAGG - Intergenic
1191724019 X:64259870-64259892 TAAGGAAGCACAGTAAGTCAGGG + Intergenic
1196703717 X:118698540-118698562 TAGGAGAGTACTGTGAGATAGGG - Intergenic