ID: 962514285

View in Genome Browser
Species Human (GRCh38)
Location 3:136135513-136135535
Sequence CCCTTTCTGATACCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962514285_962514290 14 Left 962514285 3:136135513-136135535 CCAGACTCAGGTATCAGAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 962514290 3:136135550-136135572 CACAGAAAGACCAGAGGCTTAGG 0: 1
1: 0
2: 3
3: 35
4: 318
962514285_962514292 30 Left 962514285 3:136135513-136135535 CCAGACTCAGGTATCAGAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 962514292 3:136135566-136135588 GCTTAGGAGCCAGACAGATCTGG 0: 1
1: 1
2: 16
3: 159
4: 739
962514285_962514288 8 Left 962514285 3:136135513-136135535 CCAGACTCAGGTATCAGAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 962514288 3:136135544-136135566 TAGTACCACAGAAAGACCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962514285 Original CRISPR CCCTTTCTGATACCTGAGTC TGG (reversed) Intronic
902455157 1:16528270-16528292 GTCTTGCTGATACCTGAGGCTGG - Intergenic
902473856 1:16669588-16669610 GTCTTGCTGATACCTGAGGCTGG - Intergenic
902484947 1:16737854-16737876 GTCTTGCTGATACCTGAGGCTGG + Intergenic
902497011 1:16879617-16879639 GTCTTGCTGATACCTGAGGCTGG + Intronic
902554392 1:17238534-17238556 CCCCTCCTGAGTCCTGAGTCTGG + Intronic
904466460 1:30710941-30710963 GACTTCCTGATACCTGAGGCTGG - Intergenic
905556613 1:38890519-38890541 CCCCTTCCTATATCTGAGTCTGG + Intronic
915766773 1:158371250-158371272 CTCTTTCTGTTACCAGAGACTGG + Intergenic
918436531 1:184519518-184519540 CCCATTGAGACACCTGAGTCGGG + Intronic
919002440 1:191849959-191849981 CCCTTTCTTTTTCCTTAGTCTGG + Intergenic
920818369 1:209356612-209356634 CTCTTTCTTACACTTGAGTCAGG + Intergenic
922596970 1:226821601-226821623 CCCTTCCTGTCCCCTGAGTCTGG - Intergenic
1066525381 10:36273629-36273651 TCCTTTCTGTGACCTGAGGCTGG - Intergenic
1067226685 10:44381276-44381298 CCCTTTCTTTTCCCTGAGTAGGG - Intronic
1067550004 10:47227492-47227514 CTCTTTCTTATAGCTGAGCCTGG - Intergenic
1068358592 10:55945247-55945269 CCCTCTCTGCTGGCTGAGTCTGG + Intergenic
1069608223 10:69753823-69753845 CCCTTTCTGATCCATGATACAGG + Intergenic
1069962925 10:72088872-72088894 CCCTTTCCGACACCTGAGCCTGG - Intronic
1070815976 10:79323529-79323551 CCCTCTCTGATATGTGAGCCAGG + Intergenic
1072429654 10:95359699-95359721 CCATTTCTGACTCCTGTGTCTGG - Intronic
1073566122 10:104536971-104536993 CCTTTTCTGATAAATGAGGCTGG + Intergenic
1076055573 10:127369607-127369629 ACCTTGCTGATGCCTGAGACAGG - Intronic
1077967950 11:7156011-7156033 CCCTATCTGATACCTCTGTGAGG - Intergenic
1080737280 11:35028729-35028751 CCATTTCTGTTACCTTAGTCTGG + Intergenic
1081397296 11:42601748-42601770 CCTTTTCTCCTACCAGAGTCAGG + Intergenic
1081970599 11:47195862-47195884 CTCTTTCTAATCCATGAGTCAGG - Intergenic
1083366275 11:62143331-62143353 CCCTTTCTGCTGCTTGAGTCAGG + Intronic
1090262911 11:125334373-125334395 CCCTTCCTGAACCCTGAGTATGG - Intronic
1093093916 12:14951281-14951303 ACCTTTATGATACCTGCCTCAGG + Intronic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1094393391 12:29977944-29977966 CACTGTCTGTTCCCTGAGTCAGG - Intergenic
1097407825 12:59212600-59212622 CCCTTTCTCAAACCTGCATCAGG - Intergenic
1100661799 12:96707715-96707737 TCCTTTCTGCTACCTAAGGCTGG - Intronic
1101826985 12:108228143-108228165 CCCTTCATGATACCTCGGTCAGG - Intronic
1107375626 13:39801144-39801166 CCCTATCTGAGCTCTGAGTCAGG - Intergenic
1111080640 13:83302263-83302285 GCATTTCTGATATCTGAGTATGG + Intergenic
1111103939 13:83621838-83621860 TCCTTTCTGCTGGCTGAGTCTGG - Intergenic
1115829002 14:37313486-37313508 CCCTTGCTGGTACCTAAGTGAGG + Intronic
1117172748 14:53117345-53117367 CCCTTTCTGCTTCCTGGGTGAGG - Intronic
1117712043 14:58540746-58540768 CCCTTTCTAAAACATGAGTAAGG + Intronic
1121602185 14:95213545-95213567 CCCTTTCTGATGGCTGTGGCAGG + Intronic
1126479202 15:49099309-49099331 CACTTGCTGATTTCTGAGTCTGG - Intergenic
1127754846 15:62082019-62082041 CCTTTTCTGGTACCAGTGTCAGG - Intergenic
1128043242 15:64594137-64594159 CCCTTTCAGCTACCTGGCTCTGG - Intronic
1130035913 15:80361357-80361379 CACTTTCTGGTTCCTAAGTCAGG + Intronic
1130517632 15:84638283-84638305 GCCTCTCTAATGCCTGAGTCAGG - Intergenic
1138387961 16:56648996-56649018 CCCTTTCTGGTAAGTGATTCTGG + Intronic
1138410934 16:56839738-56839760 CCCTTTCAGATACCTTGGCCTGG + Intronic
1139468238 16:67165276-67165298 TCCTTTCTGAGAACTGAGTATGG + Intronic
1139488373 16:67271940-67271962 ACCTTTCTGATCCTTGGGTCTGG + Exonic
1141029881 16:80578370-80578392 GCCTTTCTCATGCCTGAGACAGG + Intergenic
1146694905 17:34901357-34901379 CCCTTTCTGATAACAGAAACAGG + Intergenic
1146822646 17:35996913-35996935 CCCTTTCAGAGATCTGAGCCTGG - Intronic
1146885755 17:36469750-36469772 TTCTTTCTGATGGCTGAGTCTGG + Intergenic
1151439572 17:74119448-74119470 CTCTCTCTGTGACCTGAGTCGGG + Intergenic
1154162123 18:11988537-11988559 TCCTATCAGATACCTGATTCTGG - Intronic
1154257865 18:12800027-12800049 CCCTGTCTGATAAATGAGACTGG - Intronic
1155831393 18:30519181-30519203 CCCTTCCTGACACATGTGTCTGG - Intergenic
1156386808 18:36612435-36612457 ACATTTCTTATACCTGAGTGGGG + Intronic
1161852129 19:6743126-6743148 CCCTTTGTAAAACCTGAATCGGG - Intronic
1162412274 19:10513826-10513848 CCGGTTCTGATACCAGAGTCCGG + Exonic
1165682564 19:37790288-37790310 CCTTTTCTTTTACCCGAGTCAGG + Intronic
1165940231 19:39411243-39411265 CCTGTTATGAGACCTGAGTCAGG + Intergenic
1167813809 19:51860472-51860494 ATCTTTCTGATAACTGAGTTAGG + Intronic
1202706049 1_KI270713v1_random:24663-24685 GTCTTGCTGATACCTGAGGCTGG - Intergenic
925772331 2:7295184-7295206 CCCTTTCAGACTCCTGAGACTGG - Intergenic
929529001 2:42733743-42733765 CACTTTGGGAAACCTGAGTCAGG - Intronic
929954502 2:46445253-46445275 ACCTCTCTCATACCTGATTCTGG + Intronic
935145178 2:100390690-100390712 CCCTTTCTGTTCCCTGCTTCTGG + Intergenic
939955923 2:148527603-148527625 CTCTTCCTGTTACCTGAATCAGG - Intergenic
942275450 2:174319101-174319123 CCATATCTGAAACCTCAGTCAGG - Intergenic
943969565 2:194386164-194386186 TCCTCTCTGACAGCTGAGTCTGG - Intergenic
945221563 2:207489384-207489406 CCCTCCCTGATATCTGTGTCTGG + Intergenic
945977366 2:216281433-216281455 CCCTCTCTGATAGCAGAGGCAGG + Intronic
947436855 2:230080331-230080353 CCCTGCCTGATACCTGAATCTGG - Intergenic
948894170 2:240920608-240920630 CCTTTTCTGACAACTGAGGCTGG + Intronic
1169698721 20:8422455-8422477 CCATTTCTAATACCTGAGAAGGG - Intronic
1172129074 20:32643963-32643985 CCCTCTCTGATCCCTGTGGCAGG - Intergenic
1173144031 20:40509735-40509757 CCCTTACTGATTCCTGAAGCTGG - Intergenic
1173538078 20:43831004-43831026 GCATTTCTGATAACTGAGGCTGG - Intergenic
1176653600 21:9571140-9571162 CCCTTGCTGAGCCCTGCGTCTGG + Intergenic
1181330081 22:22084072-22084094 CCCTCTCAGATTCCTGAGTGTGG + Intergenic
1181388305 22:22560093-22560115 CCTTTTCTGAGACCTGAGCAGGG + Intronic
1182494313 22:30695312-30695334 ACCTTTCTCAGACCCGAGTCAGG + Exonic
1183021863 22:35033781-35033803 ACCTTGATGATCCCTGAGTCAGG + Intergenic
1183317954 22:37147309-37147331 GCCTTTCTGGAATCTGAGTCAGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
949923119 3:9019844-9019866 ACCTATTTGATACCTGTGTCTGG - Intronic
951315002 3:21179256-21179278 CCCTTTCTGCTCCCAGAGTTAGG + Intergenic
962514285 3:136135513-136135535 CCCTTTCTGATACCTGAGTCTGG - Intronic
963009079 3:140752573-140752595 CATGGTCTGATACCTGAGTCAGG - Intergenic
966321816 3:178709565-178709587 CCCTTTCTGATGTTTGAGTTAGG - Intronic
970808292 4:20061443-20061465 CCTGCTCTGATACCTGAGGCTGG - Intergenic
971241227 4:24890730-24890752 AGCTCTCTGATACTTGAGTCAGG + Intronic
972558640 4:40205633-40205655 CCCTGCCTGATACCACAGTCTGG - Intronic
972885600 4:43482389-43482411 CACATTCTGATTCCTGGGTCTGG + Intergenic
976378023 4:84366847-84366869 CCCTTCCTTTCACCTGAGTCTGG - Intergenic
977383884 4:96312713-96312735 CCCTTTCTGATACAGCATTCTGG + Intergenic
977781480 4:100986182-100986204 TCCTTTCTGCTGGCTGAGTCTGG - Intergenic
979650795 4:123128406-123128428 CTTTTTCTGATACTTGAGTCAGG + Intronic
981373352 4:143985942-143985964 CTTTTTCTTTTACCTGAGTCAGG + Intergenic
981382449 4:144089186-144089208 CTTTTTCTTTTACCTGAGTCAGG + Intergenic
986148527 5:5104566-5104588 CCTTATCTGCTACCTGATTCTGG - Intergenic
989203544 5:38789366-38789388 ACATTACAGATACCTGAGTCAGG + Intergenic
989469145 5:41795020-41795042 CCCTTTTTGGTACCTCAGACCGG + Intronic
989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG + Intergenic
990705523 5:58524656-58524678 CCCTTTCTCTTTCCTGAATCTGG + Intergenic
995153489 5:108880374-108880396 CACTTTCTGACACCCAAGTCTGG - Intronic
995690056 5:114815648-114815670 GTCTTTCTGATACCAAAGTCTGG - Intergenic
998459298 5:142297607-142297629 CCATTTCTTCTACCTGTGTCAGG + Intergenic
1000307616 5:160009733-160009755 CGCTTTCTAATGCCTGACTCTGG + Intronic
1002382210 5:178839098-178839120 CCCTTTCTGATAAAGGAGCCGGG + Intergenic
1003401587 6:5795280-5795302 TCCTTGGTGAAACCTGAGTCAGG - Intergenic
1003638140 6:7853521-7853543 CCTTTTTAGATACCTGAGACGGG + Intronic
1004230462 6:13828626-13828648 GCCTTTCTTACACCTGAGGCTGG - Intergenic
1006209510 6:32383473-32383495 TCCCTTCTGATACCGGAATCTGG + Intergenic
1006742999 6:36322639-36322661 CCCTTTCTGCCTCCTCAGTCTGG + Intronic
1007585590 6:42987087-42987109 GCCTTTCTGAGCCCTCAGTCAGG + Intronic
1010084123 6:71896382-71896404 CCCTTTCTAATGCTTGTGTCTGG - Intronic
1017257621 6:152351736-152351758 CCTTTTCTGATGCGTGAGCCAGG - Intronic
1018078505 6:160238204-160238226 CCCTTTCTGGTAACAGAGACAGG + Intronic
1018301069 6:162403611-162403633 CTATTTCTGACACCTGTGTCAGG - Intronic
1020394876 7:7703544-7703566 GCTTGTCTGAAACCTGAGTCAGG - Intronic
1021044474 7:15905877-15905899 CCCTTTCTGTTACAAGATTCTGG - Intergenic
1021894621 7:25222262-25222284 CCCATGCTGAGGCCTGAGTCTGG - Intergenic
1022509434 7:30925820-30925842 CCATTTCTGATTCCGGAGTATGG + Intergenic
1022716185 7:32900833-32900855 CCCCAGCTGATACCTGAGTTGGG + Intergenic
1023116839 7:36871108-36871130 TCCTTTCTGATACAGGATTCTGG + Intronic
1025964970 7:66261082-66261104 CCCCTTCTTATACCACAGTCTGG + Intronic
1026149554 7:67776379-67776401 ACCTTTCTGGCACCTGAGACTGG + Intergenic
1026255645 7:68708965-68708987 CCCCATCCGATTCCTGAGTCTGG - Intergenic
1029709176 7:102290189-102290211 CCCTTTCTGAGACCTGTTTCTGG - Intronic
1030066177 7:105660903-105660925 CCCTTTCTGAGTCCTCAGCCTGG + Intronic
1034269530 7:149796919-149796941 GCCTTTCTCATAGTTGAGTCAGG + Intergenic
1035970005 8:4237634-4237656 CCCTTTCTAGTAGCTGAGACTGG + Intronic
1042263248 8:66882117-66882139 CCCTATCTAATTCCTGGGTCTGG - Intronic
1042510115 8:69602558-69602580 CCCTCTCAGATCCCTGATTCTGG + Intronic
1044162324 8:88935279-88935301 CTCTTTCTTATCCCTGAGTGTGG + Intergenic
1045151867 8:99416683-99416705 CCCTTTGTGCTTCCTGAGTGAGG + Intronic
1047416516 8:124668608-124668630 CCCTTCCTAATAGCCGAGTCTGG - Intronic
1050266718 9:3898527-3898549 CCCCTTCTGATTCCTGAGCTGGG - Intronic
1052116074 9:24649641-24649663 ACCTATGTGATCCCTGAGTCAGG + Intergenic
1059718814 9:116938609-116938631 CCCTTTCAGCTAGCTGAGTGGGG - Intronic
1059929792 9:119249613-119249635 CCATTTCTGATACCTGTCACAGG + Intronic
1061672215 9:132195019-132195041 CCCTTTCTGATGCATGTTTCAGG - Intronic
1186081098 X:5932776-5932798 CTCTTTCTGTTACCTGATCCTGG - Intronic
1186361823 X:8850328-8850350 CCCTTTTTGTTACCTGAGGCAGG + Intergenic
1186847608 X:13545970-13545992 CCCTTGCTGATGACTGAGTGTGG + Intergenic
1187815225 X:23224535-23224557 CCTATTCTAATACCTAAGTCAGG + Intergenic
1189255669 X:39637043-39637065 ACCTTGCTGATCCCTGGGTCTGG + Intergenic
1192050699 X:67721534-67721556 CCCCTTCTGTTTTCTGAGTCAGG - Intronic
1197255938 X:124263194-124263216 ACCTTTCTAAGACCTGAGGCGGG - Intronic
1200574026 Y:4866550-4866572 CCCCTTCTGCTTCCTGAGTGAGG - Intergenic