ID: 962518292

View in Genome Browser
Species Human (GRCh38)
Location 3:136174041-136174063
Sequence CTTTTTCAACAGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962518292 Original CRISPR CTTTTTCAACAGATTGAGGG AGG (reversed) Intronic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901186352 1:7375854-7375876 CTTTGTCAACAGAGACAGGGTGG + Intronic
905123510 1:35701099-35701121 GTTTTTCAACGGACTGGGGGAGG - Intergenic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
905961129 1:42043381-42043403 CACTTTCAACTGATTGAAGGTGG - Intergenic
906849385 1:49231585-49231607 CTTTTGCATCAGATTCAGGCTGG - Intronic
907168014 1:52432094-52432116 TTTTTCCAACAGATTGTGGTTGG - Intronic
908132579 1:61088827-61088849 CTTTTTCACCTGAATGAAGGTGG - Intronic
908305981 1:62816719-62816741 CTTTGACAACAGACTGTGGGTGG + Exonic
909854469 1:80511014-80511036 CTTCTTCAACAGATTAAGAAAGG - Intergenic
910572417 1:88720636-88720658 TTATTTCAACAGATTTTGGGGGG + Intronic
911909199 1:103611027-103611049 CTTTTACAACATAGTGAGGTAGG + Intergenic
911913721 1:103668434-103668456 CTTTTACAACATAGTGAGGTAGG - Intronic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
915191292 1:154153088-154153110 CTTTTAAAAAAAATTGAGGGAGG - Intronic
916728164 1:167542484-167542506 CGGTTTCAATAGGTTGAGGGTGG + Intronic
919777020 1:201200787-201200809 CATTGTCACCAGATTGCGGGGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921275836 1:213519042-213519064 CATTCTCAGCAGATAGAGGGAGG + Intergenic
922084410 1:222332375-222332397 CCTTTTCCAGAGAGTGAGGGAGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
924553474 1:245099294-245099316 CTTTTTCAACAGATTGTTGAAGG + Intronic
924681138 1:246235366-246235388 CTTTTGCAACATATTCAGGAAGG - Intronic
1064178632 10:13096866-13096888 CTTTCACAACAGTTGGAGGGAGG - Intronic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1069090914 10:64197473-64197495 CTGCTTCAGCATATTGAGGGAGG - Intergenic
1069097832 10:64281400-64281422 CGGTTTCACAAGATTGAGGGCGG - Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074700252 10:116086291-116086313 CCTTTACAACAGATGGAAGGTGG - Intronic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1075895722 10:125992864-125992886 CTTTTTTAACACTTTGCGGGAGG + Intronic
1078987841 11:16612558-16612580 CTTTTTAAACACATTGAGGCGGG + Intronic
1079556627 11:21766531-21766553 GTTTATCAACAGATTAAGAGAGG - Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1084011646 11:66353443-66353465 TTTTTTTTACAGATTGAAGGTGG + Intronic
1086611427 11:88760663-88760685 CTATTTCAAAAAATTGAGGAGGG + Intronic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088880384 11:113969060-113969082 CTTTTTCAACTACTTGTGGGTGG - Intergenic
1089124949 11:116170278-116170300 CCTTTTCACCTGATGGAGGGAGG - Intergenic
1090390721 11:126385646-126385668 AGTTTTCAACAAATTGATGGGGG - Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091734808 12:2911951-2911973 TTTTTTTAAGAGATGGAGGGTGG - Intronic
1092376931 12:7963538-7963560 CATTTTTAAATGATTGAGGGTGG + Intergenic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093651062 12:21646147-21646169 ATTTTATAACAGACTGAGGGAGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094620627 12:32077055-32077077 CTTTTTCACCAGCTTGAACGGGG + Intergenic
1094644488 12:32308763-32308785 CTTTCTCAATAGACTGATGGAGG - Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1096844158 12:54396227-54396249 CCTTTTCAGTAGAATGAGGGTGG + Exonic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1101308367 12:103553912-103553934 CCTTTGCACCAGTTTGAGGGAGG + Intergenic
1103144997 12:118587922-118587944 CTTTTTCAACACACTAAGAGTGG - Intergenic
1103487377 12:121292427-121292449 CTTTTTAAAAAAATTGAGGAGGG - Intronic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1106303513 13:28490512-28490534 ATTTTATACCAGATTGAGGGAGG - Intronic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1109880474 13:68467262-68467284 CTATTTCAAAAAATTGAGGAGGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1110945292 13:81406993-81407015 TTGTGTCAAAAGATTGAGGGAGG - Intergenic
1111130371 13:83967170-83967192 ATTTTTCAAGATATTAAGGGGGG + Intergenic
1111850318 13:93565196-93565218 CCCTTTCAACAGATAAAGGGAGG - Intronic
1112755387 13:102626751-102626773 CTTTTTCAAATGTTTGAAGGGGG + Intronic
1112945175 13:104919506-104919528 CTTTAACAACAGATTTAGGAAGG + Intergenic
1113252087 13:108464755-108464777 CTTTTTCAGCAGATGGATGCAGG + Intergenic
1113261249 13:108566066-108566088 CTTTCTCAAAAGATAGAGGAGGG - Intergenic
1117146324 14:52840050-52840072 CTTTTTCAACAAATGGTGGCGGG - Intergenic
1118961608 14:70538422-70538444 CTTTTTCATCGGGGTGAGGGTGG - Intergenic
1119525757 14:75321065-75321087 CTTTTCCCAAAGTTTGAGGGAGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1125339625 15:38661751-38661773 CATTTTCAATAGTTTGAGGATGG + Intergenic
1125483554 15:40096916-40096938 CATTTTGAAGAGATTGAGTGTGG - Intronic
1126488155 15:49205964-49205986 CCTTTTCAACAAATTGTGCGGGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129662829 15:77562572-77562594 CTTTTTCATAATATTCAGGGGGG + Intergenic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1137380998 16:47999734-47999756 CATATTCAACAGATTATGGGAGG - Intergenic
1137720953 16:50627054-50627076 CTGTTTCAACAGGTTGGAGGAGG + Intronic
1138211965 16:55171015-55171037 CTGTTCTAACAGATTGAGAGAGG + Intergenic
1139002600 16:62531270-62531292 CTATTTCCAGAGACTGAGGGAGG + Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140298327 16:73730153-73730175 ATTTTTCAACACATTGATTGTGG - Intergenic
1141876240 16:86826623-86826645 TCTTTCAAACAGATTGAGGGAGG + Intergenic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1143767664 17:9148243-9148265 CTTGTTCAGCAGATTGAGAGAGG + Intronic
1144337659 17:14286180-14286202 CCTATTCAACAGATTACGGGAGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1145011333 17:19369981-19370003 CTTTTCCTGCAGATTGAGAGAGG + Intronic
1145931656 17:28690299-28690321 CAGTTCCAACAGATTGAGGCAGG + Intronic
1146253956 17:31378110-31378132 CTTTCTCCACTGATTGGGGGAGG - Intronic
1146315972 17:31807087-31807109 ATTTTTCAATGGATTGGGGGTGG - Intergenic
1148075092 17:44931172-44931194 CTTCATCAACAGATTGATTGCGG - Intronic
1148255308 17:46126082-46126104 CTTTTTCAACAGCTTTATTGAGG - Intronic
1148288866 17:46423054-46423076 CTTTCTCTACAGATTGAAGTAGG + Intergenic
1148311035 17:46640631-46640653 CTTTCTCTACAGATTGAAGTAGG + Exonic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149501351 17:57155025-57155047 CTTTTTCAACAACCTGAGTGTGG + Intergenic
1150798285 17:68257696-68257718 CTTTTTCTATAGATTTAGAGCGG + Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151682066 17:75627517-75627539 CTTTCACTACAGATTCAGGGTGG + Exonic
1153263332 18:3245264-3245286 ATTGGTCAAAAGATTGAGGGAGG + Intergenic
1155445581 18:25908754-25908776 CTTTTTCAAAAAATAGAGGAGGG - Intergenic
1156995339 18:43459134-43459156 CTTTTTCAACAGGATCAGTGAGG + Intergenic
1159170571 18:64761118-64761140 CTCTTTCAAAAAATTGAGGTTGG + Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
925109631 2:1322869-1322891 CTCTTTCAAAAGGTGGAGGGTGG - Intronic
926124895 2:10265890-10265912 CTTTGTCAACAGTTTGAGGAAGG + Intergenic
926290336 2:11524241-11524263 CTTGTTCAACAGTCTGAAGGAGG + Intergenic
926788378 2:16543454-16543476 CTTTTTAAACAGATTTATTGAGG - Intergenic
928441543 2:31296263-31296285 TTTTTTCAACATCTTGAGGCAGG - Intergenic
928768294 2:34673923-34673945 CTTTTCCAAAAGATAGAGGAGGG + Intergenic
930690316 2:54356128-54356150 TTTTTTTAACAGTTTAAGGGTGG - Intronic
930804160 2:55473271-55473293 TTTTTTTAAGAGATGGAGGGTGG - Intergenic
933524742 2:83421647-83421669 CTTATTCAATAAATTGTGGGAGG + Intergenic
934914184 2:98285698-98285720 CTTTTTCAACATTTTTTGGGGGG + Intronic
935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG + Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
939529437 2:143338897-143338919 TTTTATCAACACAGTGAGGGAGG - Intronic
940094254 2:149956199-149956221 CTTCTTCAACAGAGTGATGAGGG + Intergenic
941448370 2:165629022-165629044 TTTCTTCCACAGATTTAGGGAGG - Intronic
941996682 2:171607798-171607820 TTTTTTTAAGAGATTGGGGGGGG - Intergenic
943081608 2:183264166-183264188 CTGTTTCAACACAGTGAGGTAGG - Intergenic
943552849 2:189362183-189362205 CTTTTTCAAAAGATTCAAGATGG - Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
946670086 2:222093299-222093321 CTTATTCAACAGTTTGACTGAGG - Intergenic
946884119 2:224206006-224206028 CTCTTTCAAGAGATTGAGTTGGG - Intergenic
946995005 2:225381476-225381498 ATTTTTCAACAGACTGGGGTGGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
948998597 2:241597892-241597914 CTTTTTCTGCAAATAGAGGGAGG - Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1174442813 20:50569442-50569464 CTATTCCAACAGAGTGAGGAGGG - Intronic
1174622236 20:51884587-51884609 GTTTTTCATCAGAATGAGGCTGG - Intergenic
1178376178 21:32069368-32069390 CTCTTCCAACTGATTGAGAGTGG - Intergenic
1178755931 21:35349738-35349760 CTCTTTCAACAGTTTGAGGGAGG + Intronic
1178877519 21:36424206-36424228 GTGCTTCAACAGATTGAGTGAGG + Intergenic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1181893590 22:26086319-26086341 CATTTACAACAGATAGAGGTTGG - Intergenic
1183091026 22:35522069-35522091 CTTTTTCTAGAGAGAGAGGGAGG - Intergenic
1184084669 22:42253355-42253377 CTTCTTCAACAGATACAGGACGG + Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949981400 3:9504020-9504042 TTTTTTTAAGAGATTGGGGGAGG - Intronic
950873094 3:16246062-16246084 CTTTTTCAAGAGATTATGGCTGG + Intergenic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
959209703 3:103362141-103362163 CTATTTCAAAAAATTGAGGGGGG + Intergenic
959218718 3:103486263-103486285 TTTTTTCAACAAATTGTGTGTGG + Intergenic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962597506 3:136961478-136961500 CTTTTTCAAAACAATGTGGGTGG + Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963662724 3:148148119-148148141 ATTTCTCAGCAGAATGAGGGTGG + Intergenic
963975171 3:151472486-151472508 CCTTTTCAGAAGAGTGAGGGTGG - Intergenic
963996247 3:151712406-151712428 TTATTTCAACAGATTTGGGGGGG - Intergenic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
968855329 4:3116010-3116032 CTTTTTTAACAGATTAAGCCGGG + Intronic
970418643 4:15883754-15883776 CATATTCAACAGATTGTAGGAGG + Intergenic
970461797 4:16281847-16281869 CTTATTCAACAGATTACAGGAGG - Intergenic
975196587 4:71531930-71531952 CTTCATCAACAAATTGAAGGAGG - Intronic
976256680 4:83107708-83107730 CTTTTTCTACACAATAAGGGAGG + Intronic
976413359 4:84742772-84742794 GTTTTTCCACAGACTAAGGGGGG - Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
980723265 4:136724088-136724110 CTTTGGCAAAATATTGAGGGTGG + Intergenic
981852697 4:149249847-149249869 CTTATTCAGCAGATTGAATGTGG - Intergenic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982416245 4:155135748-155135770 TTTTTTAAACAAAGTGAGGGAGG - Intergenic
982533129 4:156572472-156572494 CTTTGGCAATAGATTGTGGGTGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
987075037 5:14373323-14373345 CTTTTTCAGTAGATGGAGCGAGG - Intronic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990167193 5:53007697-53007719 CTTTTTCATAAGATTGCTGGAGG - Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
994642776 5:102430832-102430854 CTATTCCAACAAATTGAGGAGGG - Intronic
994734702 5:103538252-103538274 GTTTTTCAACAGAGAGAAGGAGG - Intergenic
994808928 5:104488047-104488069 TTTTTTCAACAGGTCTAGGGTGG + Intergenic
996103189 5:119466349-119466371 CTATTTCAAAAAATTGAAGGGGG - Intronic
996115900 5:119618104-119618126 TTTTTTTAAAAGATTGAGGTTGG - Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998925848 5:147125417-147125439 CTATTTCAAAACATTGAGGAGGG - Intergenic
999610019 5:153359300-153359322 TTATTTTAACAGAGTGAGGGGGG - Intergenic
1000104186 5:158043254-158043276 CTTTTTGAAATTATTGAGGGAGG + Intergenic
1000212801 5:159123435-159123457 CTTTTTCCAAAAATAGAGGGGGG - Intergenic
1000958321 5:167569334-167569356 CTTTGTTTACAGATTGTGGGAGG + Intronic
1001283841 5:170408046-170408068 CTTCTAGAACAGATTAAGGGTGG + Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1003355500 6:5365686-5365708 AATTTTCAACTGACTGAGGGAGG - Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1005370026 6:25122819-25122841 CTAAGTCAACAGATTCAGGGTGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1008014356 6:46501642-46501664 CTGATTCAATAGATAGAGGGTGG - Intergenic
1008078193 6:47167866-47167888 TCTTTTCAAAAGATAGAGGGAGG + Intergenic
1008369684 6:50718218-50718240 CATTTTCACCATATTGAGGCAGG - Intronic
1010207780 6:73338323-73338345 CATTTTCAACAGATTTACTGAGG - Intergenic
1014280571 6:119438616-119438638 CCTTTTCCACAAACTGAGGGTGG - Intergenic
1015166430 6:130205041-130205063 CTTTTTCAAGAGGTAGAGAGAGG - Intronic
1016952984 6:149599222-149599244 CTTTTTCAACAAATGGAGAGAGG + Intronic
1018606585 6:165603882-165603904 CTGCTTCAGCAAATTGAGGGTGG - Intronic
1020209929 7:6151273-6151295 TTTTTTTAACAAATTGAGTGCGG - Intronic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1021544003 7:21792439-21792461 CTTTTTCAAAAAATTGAAGAGGG - Intronic
1021986213 7:26100836-26100858 CATTTTGAAGAGATTGCGGGTGG - Intergenic
1023886368 7:44360105-44360127 CTCTTTCATTAGTTTGAGGGTGG + Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1028572808 7:92310062-92310084 ATTTTTCAAAAAATTGAGAGTGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1030475203 7:110023312-110023334 CATTTTCTATAGGTTGAGGGAGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031676051 7:124613751-124613773 CTTTATCAAAAAATTTAGGGGGG - Intergenic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033026379 7:137777183-137777205 TTTTTTTAACAGATTGGTGGGGG - Intronic
1035306320 7:157935172-157935194 CTTTTTCACCAGGTGGAGGGTGG + Intronic
1037566124 8:20119873-20119895 CTCATTCAACAGATTTAGGAGGG - Intergenic
1037711659 8:21360193-21360215 TTTTTGCAATAGATTGAAGGAGG + Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1039110359 8:34034991-34035013 CTTTTTCCAGTGCTTGAGGGTGG + Intergenic
1040452412 8:47561416-47561438 CTTCTTCAAGTGGTTGAGGGAGG - Intronic
1040955808 8:52978733-52978755 CAGTTTCAACAGATTGGGGCTGG + Intergenic
1040999027 8:53431429-53431451 GTTTTCCAACTGATTGAGGCAGG + Intergenic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1043732950 8:83707921-83707943 CTTGTGCAACAGATTGAATGAGG + Intergenic
1044477418 8:92644914-92644936 CTTTATCATCAGATTCATGGTGG + Intergenic
1044788358 8:95820564-95820586 GCTTTTCAACTGATTGAGTGAGG - Intergenic
1045146463 8:99350145-99350167 CTTTTCAAACAGAATGAAGGGGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048916768 8:139191660-139191682 TGTATTCAACAGATTGAGGAAGG + Intergenic
1049050136 8:140188157-140188179 ATTCTTCAGCAGGTTGAGGGTGG + Intronic
1049247924 8:141572565-141572587 ATTTGTCAAAAGCTTGAGGGAGG + Intergenic
1050911728 9:11080187-11080209 ATCTTTGAACAGATTGAGTGTGG - Intergenic
1051212430 9:14758658-14758680 CTTTTTCATCAGATGGTGGGGGG + Intronic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1054767743 9:69056334-69056356 CATATTCAACAGATTATGGGAGG + Intronic
1055754579 9:79544026-79544048 CTTTTTAAACAAATTGATGCTGG - Intergenic
1055906621 9:81302158-81302180 CTTTTTCAAAAAATTGAGATGGG - Intergenic
1056377211 9:86026058-86026080 CTTAGTCCACAGTTTGAGGGTGG + Intergenic
1056889631 9:90478700-90478722 CTTTTTCATCAGACTCAGGCTGG - Intergenic
1058606162 9:106725886-106725908 CTTTTTTAAGAGAATGAAGGAGG + Intergenic
1058709893 9:107670199-107670221 CTTTGTGATGAGATTGAGGGTGG - Intergenic
1061466548 9:130785140-130785162 CTTTGTCAACAGAGTGCTGGAGG + Intronic
1061700025 9:132409007-132409029 CTTTTTCACCAAGTTGTGGGTGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1186023185 X:5279890-5279912 AGTTTTCAACAGATTGAGTGAGG - Intergenic
1188678549 X:32973398-32973420 CTACTTCAACAGATAGAGGATGG + Intronic
1190224648 X:48535770-48535792 CTTTTTTAACAGAATTAAGGAGG + Intergenic
1192956449 X:76075833-76075855 TTTTTTCCCCAGACTGAGGGTGG - Intergenic
1194910435 X:99636018-99636040 GTTTTTCAACAAATTGTGTGGGG + Intergenic
1194986184 X:100492168-100492190 CATTTTGAGAAGATTGAGGGAGG - Intergenic
1195195662 X:102495416-102495438 CTTTATCTACACAATGAGGGTGG + Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1197180787 X:123533824-123533846 ATTATTAAAAAGATTGAGGGAGG - Intergenic
1197374004 X:125659993-125660015 CTTTGTCAACAGATTGACAATGG + Intergenic
1198323745 X:135545881-135545903 CTTTTTCATCAAATTGGGAGGGG - Intronic
1199297756 X:146178316-146178338 GATCTTCAACAGATTGAGTGAGG - Intergenic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic