ID: 962520710

View in Genome Browser
Species Human (GRCh38)
Location 3:136195762-136195784
Sequence AACTGCGGGCTGCAACCCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962520710_962520717 -4 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520717 3:136195781-136195803 AGTTCCCCGAGGTGGCGAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 93
962520710_962520716 -7 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520716 3:136195778-136195800 CGCAGTTCCCCGAGGTGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 76
962520710_962520727 20 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520727 3:136195805-136195827 CGGGAGTCCTCAACCCGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 42
962520710_962520724 15 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520724 3:136195800-136195822 GCGGGCGGGAGTCCTCAACCCGG 0: 1
1: 0
2: 0
3: 6
4: 51
962520710_962520730 28 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520730 3:136195813-136195835 CTCAACCCGGAGGGGAAGGCCGG 0: 1
1: 0
2: 1
3: 10
4: 149
962520710_962520722 1 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520722 3:136195786-136195808 CCCGAGGTGGCGAGGCGGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 259
962520710_962520725 18 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520725 3:136195803-136195825 GGCGGGAGTCCTCAACCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 69
962520710_962520728 24 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520728 3:136195809-136195831 AGTCCTCAACCCGGAGGGGAAGG 0: 1
1: 0
2: 1
3: 4
4: 110
962520710_962520726 19 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520726 3:136195804-136195826 GCGGGAGTCCTCAACCCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
962520710_962520720 0 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520720 3:136195785-136195807 CCCCGAGGTGGCGAGGCGGGCGG 0: 1
1: 0
2: 0
3: 40
4: 228
962520710_962520732 30 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520732 3:136195815-136195837 CAACCCGGAGGGGAAGGCCGGGG 0: 1
1: 0
2: 1
3: 14
4: 155
962520710_962520718 -3 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520718 3:136195782-136195804 GTTCCCCGAGGTGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 319
962520710_962520731 29 Left 962520710 3:136195762-136195784 CCCGTGGGTTGCAGCCCGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 962520731 3:136195814-136195836 TCAACCCGGAGGGGAAGGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962520710 Original CRISPR AACTGCGGGCTGCAACCCAC GGG (reversed) Exonic
902727477 1:18346821-18346843 GAGTGGGGGCTGCAGCCCACAGG + Intronic
904390234 1:30180163-30180185 AACTGGGGGCTGCAAACAACAGG - Intergenic
912186333 1:107280732-107280754 AACTGCAGGCTGCAAGCCTCAGG + Intronic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
913999994 1:143685797-143685819 CACTGCAGGCTGCACCCCCCGGG + Intergenic
921590985 1:217002842-217002864 AACTGGTGACTGCAACCCCCTGG + Intronic
923543954 1:234910431-234910453 AACTGCAGGTTGGAATCCACTGG - Intergenic
924258805 1:242209109-242209131 CACAGCGGTCTTCAACCCACAGG - Intronic
1065122432 10:22542852-22542874 ATCTGCGGGCTGGACCCAACTGG + Intronic
1069150937 10:64958871-64958893 CACTGAGGGTTGCAAACCACTGG + Intergenic
1069641816 10:69961279-69961301 CTCGGGGGGCTGCAACCCACTGG - Intronic
1073050053 10:100661505-100661527 AACTGGGGGCTGCAAAGCATTGG + Intergenic
1081669769 11:44936586-44936608 GACTGCAAGCTCCAACCCACTGG + Intronic
1082966568 11:58972367-58972389 AACTGAGGGCTTCATCTCACTGG + Intronic
1084543191 11:69800076-69800098 AACTGTGGACTCAAACCCACTGG + Intergenic
1089577735 11:119458703-119458725 CACTGCAGGCTCCACCCCACGGG - Intergenic
1099011437 12:77295935-77295957 AACTGTGGCTTGCAATCCACTGG - Intergenic
1102988016 12:117294303-117294325 AACTGTCGGCTGCCGCCCACAGG - Intronic
1104570082 12:129917523-129917545 AACTGCAGGCACCAGCCCACTGG + Intergenic
1105549478 13:21379888-21379910 CACTGCGGGCTCCAACCCCCGGG + Intronic
1107394126 13:39997463-39997485 AACTGCAGGCTCCAGCCCCCAGG + Intergenic
1107661576 13:42644355-42644377 CACTGCGGCCTGCAACTCCCAGG + Intergenic
1112365965 13:98755728-98755750 AAATGGGGGCTGCAAGTCACAGG + Intergenic
1114822717 14:26040979-26041001 AGCTGCTGTCTGCAACCCAAGGG + Intergenic
1117652566 14:57922119-57922141 CACTGCAGGGTGCAACCCTCTGG + Intronic
1117691642 14:58313549-58313571 TACTGGGGTCTGCAACCCCCAGG - Intronic
1118322202 14:64759761-64759783 CACTGAGGGCTGCCACCCACCGG + Intronic
1118870412 14:69736671-69736693 AACTGGGGGTTTCAACCCATTGG - Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1137784920 16:51130615-51130637 AACTGCAGGATGTGACCCACTGG - Intergenic
1139436451 16:66939356-66939378 AACTGTGGCCTGACACCCACCGG - Exonic
1141848652 16:86628980-86629002 AACTCGGGCCTGCAACCCCCAGG - Intergenic
1142354350 16:89595297-89595319 ACATGCGCCCTGCAACCCACGGG - Intronic
1143260529 17:5595258-5595280 CACTGCGTTCTGCCACCCACTGG + Intronic
1152393602 17:80017760-80017782 CACTGCCATCTGCAACCCACAGG - Intronic
1152735171 17:81993725-81993747 AACTGCTTGCAGCAACCCTCCGG - Intronic
1154996592 18:21646470-21646492 AACTGCAGGTTGCAACCCATTGG + Intergenic
1155605628 18:27602424-27602446 AACTGATGGATGCAATCCACAGG + Intergenic
1157337327 18:46750888-46750910 AACTGAGGGTTTCAACCCAACGG + Intronic
1160017949 18:75158519-75158541 ACCTGCGGGCCGCAACCTTCAGG - Intergenic
1161216026 19:3095396-3095418 ACCTTTGGGCTGTAACCCACAGG + Intronic
1166014060 19:39966817-39966839 AACCGCAGGCTGAAACCCTCCGG + Intergenic
925240849 2:2325957-2325979 AACTGGGAGCTGCAACCACCAGG + Intronic
932093813 2:68829343-68829365 AACTGCTGGCTGGATTCCACGGG + Intergenic
933367427 2:81371196-81371218 AACTGCGAGCTTCATCACACAGG - Intergenic
946475450 2:220002318-220002340 AACTGAGGCCTGCAAACCCCAGG - Intergenic
1175326939 20:58136284-58136306 GACTTCGCGCTGCAACACACAGG - Intergenic
1180070719 21:45434778-45434800 CTCTGGGGGCTGCAACCCACCGG - Intronic
1180079308 21:45479677-45479699 AGCTGCGGGCAGCATCCCTCGGG - Intronic
1183094755 22:35545469-35545491 AAGTGGGGGCTGCATCCCAGAGG - Intronic
1183231042 22:36582239-36582261 AAATTCTCGCTGCAACCCACAGG + Intronic
1183250028 22:36723935-36723957 ACCTGCGACATGCAACCCACTGG + Intergenic
1184242707 22:43219799-43219821 AACTGAGGTCTGCCCCCCACGGG - Intronic
1184892686 22:47389467-47389489 AACTGGGGGATGCTGCCCACGGG + Intergenic
950148599 3:10669097-10669119 AACTGGGGGCTGGGACCCTCTGG + Intronic
952272658 3:31847930-31847952 AGCTGTGGGCTGCATCCCCCTGG - Intronic
954082121 3:48218489-48218511 AACTGGGGGCTGAAATCCAGGGG + Intergenic
954755520 3:52837281-52837303 AACTTGGGGCTGCACCCTACAGG + Exonic
962452240 3:135529864-135529886 AAATCCGGGCTGTAAGCCACAGG - Intergenic
962520710 3:136195762-136195784 AACTGCGGGCTGCAACCCACGGG - Exonic
962948755 3:140198822-140198844 AATTGCAGGCCACAACCCACAGG - Intronic
969407987 4:7007648-7007670 AACTGCCTGCTGCAAGCCAGTGG - Intronic
977562462 4:98546404-98546426 AACTGCAGGGTGCAAACCATTGG + Intronic
990599421 5:57342527-57342549 AACTGTGTGCTTCAACACACAGG - Intergenic
990687764 5:58326357-58326379 AACTGCAGATTGCAACCCATTGG + Intergenic
994143855 5:96371058-96371080 AACTGGGGTCTGCAAGACACAGG - Intergenic
997817502 5:137033220-137033242 CACTGCAGGCTGCAGCACACCGG - Intronic
997960731 5:138318958-138318980 AACTCAAGGCTGCAACCAACTGG + Intronic
1001949666 5:175807485-175807507 GACAGCAGGCTGCAGCCCACAGG + Intronic
1005398723 6:25409900-25409922 AACTGAGGGCTACAACCCATTGG - Intronic
1005480100 6:26247473-26247495 CACTGCAGGCTCCACCCCACGGG - Intergenic
1018541834 6:164889197-164889219 AACTGGGGGCTGCAGCCATCTGG + Intergenic
1019171275 6:170134619-170134641 ACCTGCCGGCTACACCCCACCGG - Intergenic
1019443044 7:1056968-1056990 TCCTGTGGGCTGCGACCCACAGG + Intronic
1019639710 7:2096918-2096940 ACCTCCAGGCTGCCACCCACAGG + Intronic
1020829159 7:13071863-13071885 AACTTCGGGCTGCCTCCAACAGG + Intergenic
1030386097 7:108870236-108870258 ACCTGCATGCTGCATCCCACAGG - Intergenic
1035017775 7:155781618-155781640 AGCCGCGGGCTGCAACCCAGCGG - Intergenic
1035058633 7:156052912-156052934 AACTGTGGGTTGCAAACCATTGG + Intergenic
1039413437 8:37374666-37374688 AGCTGCGGGCTGCAGCCTAATGG - Intergenic
1040869005 8:52080740-52080762 AACTGCGGACCTCACCCCACTGG - Intergenic
1041597340 8:59671053-59671075 AAGTGCAGGTTGCAACCCATTGG + Intergenic
1047789401 8:128187233-128187255 AACGGCTGGTTGCATCCCACTGG - Intergenic
1048490942 8:134893213-134893235 AACAGCAGCCTGCAAGCCACTGG - Intergenic
1049164334 8:141117087-141117109 AACTGCTGCCTGGAGCCCACAGG + Intergenic
1053201109 9:36152039-36152061 AAGGGCGGGCAGCAAACCACAGG - Intronic
1055581703 9:77712787-77712809 AACTGCCTGCAGCAACCCCCTGG + Intergenic
1059965055 9:119605711-119605733 ATCAGCAGGCTGCAGCCCACAGG - Intergenic