ID: 962529157

View in Genome Browser
Species Human (GRCh38)
Location 3:136262921-136262943
Sequence CTAGTTGAATACATCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962529155_962529157 14 Left 962529155 3:136262884-136262906 CCACATTTTAGAGCTTGACTGGA 0: 1
1: 0
2: 1
3: 8
4: 108
Right 962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG 0: 1
1: 0
2: 1
3: 13
4: 167
962529153_962529157 17 Left 962529153 3:136262881-136262903 CCACCACATTTTAGAGCTTGACT 0: 1
1: 0
2: 0
3: 8
4: 135
Right 962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962529157 Original CRISPR CTAGTTGAATACATCTTTAT GGG Intronic
907430401 1:54407700-54407722 CTGTTTGGATACATCTTTAGGGG + Intronic
907764050 1:57390649-57390671 GAAGCTGAATTCATCTTTATAGG - Intronic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
908394187 1:63710330-63710352 CTATTTTAATACAGCTTTCTTGG + Intergenic
911049964 1:93662403-93662425 CTAGTTGAATACAACTTGAGAGG - Intronic
915924965 1:160010219-160010241 CTAGTTAAATTCCTCTTTAAGGG - Intergenic
916326840 1:163571011-163571033 CTTGTTGAATAAATCTAAATGGG + Intergenic
917282292 1:173389641-173389663 ATAAATGAATACATCTTTTTGGG - Intergenic
918291574 1:183113379-183113401 ATATTCGAATACATCTTTTTTGG - Intronic
919000389 1:191824488-191824510 CTAATGGAATACATATATATAGG + Intergenic
924012562 1:239681590-239681612 CTAATTTATAACATCTTTATTGG - Intronic
1063572852 10:7232242-7232264 CTATTTGCACACATCATTATTGG + Intronic
1063892543 10:10645206-10645228 CTTGTTGAATACATGTTTCAGGG + Intergenic
1066156289 10:32681470-32681492 TAAGTTGAAAACCTCTTTATAGG - Intronic
1068370758 10:56110237-56110259 TCAGTTGACTACATATTTATAGG - Intergenic
1069032942 10:63617396-63617418 AAAATTGAATACATGTTTATTGG - Intronic
1069136690 10:64775925-64775947 TTAGTTGAAAATATCTCTATTGG + Intergenic
1080127021 11:28747016-28747038 CTAGTGGAATACTTCTTTTAAGG + Intergenic
1087317474 11:96620046-96620068 GATGTTGAATACATTTTTATGGG + Intergenic
1087417291 11:97872907-97872929 CTAGTTGAATACGTGAATATTGG + Intergenic
1088061631 11:105658952-105658974 CTAGTTGAATATCATTTTATTGG - Intronic
1088202368 11:107352342-107352364 CAAGTTGCTTACAGCTTTATGGG - Intronic
1095073385 12:37886350-37886372 ATAGTTTAATACTTCTTTAATGG - Intergenic
1099029465 12:77507269-77507291 CTAGATGAATTCTTCTATATAGG + Intergenic
1099445444 12:82746409-82746431 TTAATTGAACACATATTTATGGG + Intronic
1100080789 12:90847451-90847473 CTAGTTAAATCCATGTTGATAGG + Intergenic
1102848678 12:116216853-116216875 CTAGTTAGATACATCTTTGTTGG - Intronic
1108274862 13:48797432-48797454 CTAGTTGTGATCATCTTTATAGG - Intergenic
1115999004 14:39223259-39223281 TTAGTGGAGTACATTTTTATTGG + Intergenic
1117712081 14:58541293-58541315 CTAGTGGAGCACATCTTTAATGG + Intronic
1117764019 14:59061220-59061242 CCATTTGAAGACATCTTTATGGG + Intergenic
1120395324 14:83960707-83960729 TTAGTTAAATACATCATGATTGG + Intergenic
1120802359 14:88704978-88705000 CTACTTGTATACATTTTTAAAGG - Exonic
1121625013 14:95377506-95377528 GTAGTTGTATCCATCTCTATCGG + Intergenic
1124939186 15:34202221-34202243 AGAGTTGAATACTACTTTATTGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1129430394 15:75496863-75496885 AGAGTTGAATACATGATTATAGG + Intronic
1130368778 15:83264870-83264892 CTAGTGGACTACATTTTTAGAGG - Intronic
1131071434 15:89468816-89468838 ATAGTTGGATACATCTTTCAAGG + Intergenic
1134359587 16:13518700-13518722 TTATTTCAATACATCTTTAGAGG - Intergenic
1134852009 16:17487133-17487155 CCAGTTGAATAGATATTTCTTGG - Intergenic
1138715912 16:59021769-59021791 CTAGTTGAATAGAGCTTTCAGGG + Intergenic
1139255099 16:65533293-65533315 GTAGTTGGATACATATTTACAGG - Intergenic
1140659478 16:77174085-77174107 TTATTAGAATACATATTTATTGG - Intergenic
1142536908 17:624312-624334 CTAGTTGAAGAGATGATTATTGG - Intronic
1142826632 17:2516571-2516593 CAAGTGGAAAACATCATTATTGG - Intergenic
1146018077 17:29249521-29249543 CTAGTAGTAAATATCTTTATGGG - Intronic
1151587768 17:75021172-75021194 CTGGTTGCAGACGTCTTTATAGG + Exonic
1153026079 18:674190-674212 CTAGCTGAACTCATCTTGATCGG + Exonic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1158019235 18:52821677-52821699 CTAGCTGAGTACTTCTTTATTGG + Intronic
1159408918 18:68043756-68043778 CTAATTGCATACATCTTTAAAGG + Intergenic
926366917 2:12141640-12141662 CTGTGTGAATGCATCTTTATGGG - Intergenic
930531560 2:52595159-52595181 CTAACTGAATACATCGTTAGGGG - Intergenic
930943631 2:57044596-57044618 CTAGTTGCCTACAACTTGATAGG + Intergenic
931904328 2:66825962-66825984 CTAGTTGCAGACATGTTTCTGGG + Intergenic
933418106 2:82013281-82013303 GTATTTGAATACATCTCTCTAGG + Intergenic
936772282 2:115928406-115928428 TTAGTTGATTACATTTATATGGG + Intergenic
936829131 2:116620167-116620189 TTAGTTGAATATATATATATGGG - Intergenic
939366774 2:141243587-141243609 ATAGTTGAATAGTTTTTTATAGG - Intronic
940469424 2:154076279-154076301 ATAGTTAAACACATCTTAATGGG + Intronic
940748333 2:157596078-157596100 GTAATTCAGTACATCTTTATTGG - Intronic
944279854 2:197883464-197883486 CTAGTTGGATACATCAGTGTTGG + Intronic
945895046 2:215472030-215472052 CTACTTGAATATCTGTTTATAGG - Intergenic
947232850 2:227905535-227905557 CTTGTTGCATACATCTTGGTTGG - Intronic
1169716177 20:8621027-8621049 CTAGTTGATGAGTTCTTTATTGG - Intronic
1173345540 20:42196360-42196382 CTAATTATATACATATTTATGGG + Intronic
1174994245 20:55547566-55547588 CTATTTTTATAAATCTTTATTGG + Intergenic
1178001815 21:28168949-28168971 CTTGTAGACTACATCTTTGTGGG - Intergenic
1179292761 21:40033061-40033083 CTGGTTACATACATCTGTATTGG - Intronic
1181865347 22:25850420-25850442 CTAGGTGAATTCATCTCTCTGGG + Intronic
1182344208 22:29648945-29648967 TTATTTAAATATATCTTTATTGG + Intronic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
950934247 3:16822550-16822572 CTACTTGAATACATGTCAATTGG - Intronic
951333671 3:21395216-21395238 CTATTTCAAGACATCTTCATTGG + Intergenic
952628172 3:35432270-35432292 CCAGTTGAATATATCTATATGGG + Intergenic
956538741 3:70309729-70309751 CTAGATGACAACATCTTAATTGG - Intergenic
957361276 3:79162230-79162252 CTAGTGAAATACATTTTTACTGG - Intronic
958845380 3:99259499-99259521 ATAGTTGAATACATCTTTCAAGG - Intergenic
959365381 3:105451755-105451777 CTATTTTAATACAGCTTTCTTGG + Intronic
959445031 3:106428467-106428489 CTTATTGAATAGATGTTTATAGG - Intergenic
961599616 3:128050720-128050742 CTAGTTTAAAATATTTTTATTGG - Intergenic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
964348534 3:155779743-155779765 GTAGTTGAAGACATCTTTATTGG - Intronic
964782054 3:160350513-160350535 CTGGTGGCATACATCTTTATTGG - Intronic
965114677 3:164473228-164473250 TCAGTTGACTACATCTATATAGG + Intergenic
967760628 3:193221560-193221582 CCACTTGTATACATCTTTTTTGG + Intergenic
970037835 4:11758675-11758697 ACATTTGAGTACATCTTTATTGG - Intergenic
970807450 4:20053251-20053273 CTTGTTGCATTTATCTTTATGGG - Intergenic
970861825 4:20713100-20713122 ATACTTGAAGACATCTTTAGAGG + Intronic
971088848 4:23315576-23315598 CTATTTTGATACAACTTTATTGG - Intergenic
971233730 4:24822132-24822154 CAAATTGAATGGATCTTTATAGG + Intronic
973323011 4:48829381-48829403 TTTGTTGAATGCATTTTTATAGG - Intronic
973804056 4:54508005-54508027 ATAGTTGAAAACATTTTCATGGG + Intergenic
973944166 4:55940632-55940654 ATAGTTGGATACATCTTTCCAGG - Intergenic
974128059 4:57719722-57719744 CTTGTTGAATGAATTTTTATTGG + Intergenic
974153011 4:58034192-58034214 CTAGTTGACTATATCTGTGTGGG - Intergenic
974659425 4:64866490-64866512 CTACCTGAATATATATTTATTGG - Intergenic
975273287 4:72464311-72464333 CTAGGTGAATAAATGGTTATAGG + Intronic
976516041 4:85967814-85967836 CTAGTTTAGTAGATCTTCATTGG + Intronic
976526210 4:86092207-86092229 TTATTTTAATATATCTTTATGGG + Intronic
976880318 4:89914514-89914536 CTAAATGAATAGAACTTTATTGG + Intronic
977149997 4:93499390-93499412 GGAGTTGTATTCATCTTTATTGG - Intronic
977953264 4:102998809-102998831 CTATTTGCATATATCTTTTTTGG + Intronic
979861307 4:125697036-125697058 CTATTTGAATTCATGTTTCTTGG - Intergenic
981661519 4:147172731-147172753 TTAGTTGAATATATTTTTAATGG - Intergenic
982875726 4:160646900-160646922 CTAGCTGTATACATGTTTGTAGG - Intergenic
982954846 4:161751329-161751351 CTTTTTGAATACATGTTTATAGG + Intronic
983024876 4:162723908-162723930 GTAGTTGAGTAAATTTTTATGGG - Intergenic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983791579 4:171804442-171804464 ATAATAGAATACATGTTTATGGG + Intergenic
983818637 4:172165798-172165820 CTAGTGGAATATATCTGTGTTGG - Intronic
984364876 4:178785632-178785654 GAAGTAGAATACATCTATATTGG - Intergenic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
986112021 5:4728678-4728700 CTTGTGGAATTCTTCTTTATGGG + Intergenic
986970235 5:13326196-13326218 CTAGTTGAATCCATTTTCTTAGG - Intergenic
987739733 5:21891693-21891715 ATAGTTGAATTTATCTCTATAGG + Intronic
987868958 5:23587106-23587128 CTAGTTGAATACATCAACAATGG + Intergenic
987957339 5:24757364-24757386 CTAGTTTAATTCTTCTTCATAGG + Intergenic
988329011 5:29810534-29810556 GTAGTTGCGCACATCTTTATAGG + Intergenic
991258685 5:64643397-64643419 CAAATTCAATACATCTTTAAGGG + Intergenic
991475024 5:67010236-67010258 TTAGTTGGATACTTGTTTATTGG - Intronic
991590789 5:68249683-68249705 CTATTTAAATGCAGCTTTATGGG - Intronic
994269415 5:97759538-97759560 GTAGGTGAATACATATTTATTGG + Intergenic
995596258 5:113751754-113751776 ATTATTGAATACATATTTATAGG + Intergenic
995826685 5:116307234-116307256 CTAGCTGAATACATCTAATTGGG + Intronic
996148272 5:120002081-120002103 CTGGATAAATACATTTTTATGGG - Intergenic
998928942 5:147158886-147158908 CTAATTGATTATATCTTTCTGGG + Intergenic
999036233 5:148353706-148353728 CTAGTTGGATACATAATTTTTGG + Intergenic
1000273787 5:159713432-159713454 TTTGTTGAAGACATTTTTATTGG - Intergenic
1000866146 5:166517757-166517779 GAAATTGAATACATATTTATTGG + Intergenic
1004227207 6:13796987-13797009 CTAGGTGATTTAATCTTTATGGG + Intronic
1009729895 6:67588020-67588042 TTAGTTGACTATATCTGTATGGG + Intergenic
1011251454 6:85376373-85376395 TAAGTTGAAGACATATTTATTGG + Intergenic
1013712824 6:112921181-112921203 CTGTTTGCATACTTCTTTATGGG + Intergenic
1014528638 6:122532598-122532620 CTATTTGAATCCATCTATATGGG - Intronic
1015997768 6:139012562-139012584 CTAGTTGCATACATTTTTGATGG - Intergenic
1017229631 6:152059040-152059062 CTAGTTGAAAAAATATTAATTGG + Intronic
1017273952 6:152543945-152543967 CTAGGTGAATTCATCATTGTGGG - Intronic
1020554073 7:9647854-9647876 ATACTTGAATAGATGTTTATGGG + Intergenic
1021174777 7:17438567-17438589 CCATTTGAATCCATATTTATGGG + Intergenic
1026536667 7:71244206-71244228 CTAGTTCAATGCATCCTTCTTGG + Intronic
1028818036 7:95171085-95171107 CTTGTTGTATAACTCTTTATTGG - Intronic
1033869203 7:145729558-145729580 CTAGGTGAATACATTTTTGTTGG + Intergenic
1035936313 8:3844661-3844683 CTATTTGAATTCATCATTGTCGG + Intronic
1037474157 8:19239830-19239852 GGACTTGAATACATCTTTTTGGG + Intergenic
1037589285 8:20299898-20299920 GTAGTTGGATACTTCTTTGTTGG + Intronic
1038046858 8:23772777-23772799 CCAATTTAATACTTCTTTATAGG + Intergenic
1038074285 8:24052781-24052803 GTAGTTGTATATATATTTATTGG + Intergenic
1039222426 8:35348169-35348191 ATACTTTAATACATTTTTATAGG - Intronic
1041537189 8:58939839-58939861 CTAGCTGAATACCTCTTTCATGG + Intronic
1042132042 8:65596677-65596699 TTTATTGTATACATCTTTATGGG + Intergenic
1042680601 8:71379291-71379313 CTGGATGAATACATCTCTACAGG + Intergenic
1043212581 8:77542417-77542439 CTATTTGAATATATTTTTTTGGG - Intergenic
1043276629 8:78404551-78404573 ATAGTTAAATAGATCTTTTTGGG - Intergenic
1043996815 8:86828133-86828155 CCAGTTGTATATATTTTTATTGG + Intergenic
1044408806 8:91861955-91861977 CTATTTGATTACATCATTGTAGG - Intergenic
1045772730 8:105762869-105762891 AAAGTTGAGTAGATCTTTATTGG + Intronic
1046341801 8:112868704-112868726 TTAGTTGACTATATATTTATGGG - Intronic
1046758840 8:117999214-117999236 TTATTTGATTACATTTTTATTGG - Intronic
1046978686 8:120312640-120312662 GTAGTTGAAAATATATTTATAGG - Intronic
1047603597 8:126452079-126452101 ACAGTTGAAAACATGTTTATGGG - Intergenic
1047859530 8:128949634-128949656 TCAGTTCAATACAACTTTATTGG + Intergenic
1050666423 9:7942624-7942646 CAAATTGAATACAATTTTATAGG + Intergenic
1051813275 9:21075174-21075196 CTAGTTGCCTTCATTTTTATTGG + Intergenic
1052346397 9:27414070-27414092 CTAGTTCAATAAATCTGGATGGG + Intronic
1055569869 9:77605686-77605708 CTAGTTGGATAGGTCTTTGTCGG - Intronic
1055817729 9:80226923-80226945 CTATTTGAATAATTCTTTTTTGG + Intergenic
1058142202 9:101368730-101368752 TTATTTGTATACTTCTTTATAGG - Intronic
1060115818 9:120939445-120939467 CCCTTTGAATAAATCTTTATAGG + Intergenic
1060701456 9:125753554-125753576 AGAGTTCAATACATTTTTATTGG - Intronic
1061703162 9:132431872-132431894 GTAGTTCAATAAATCTTTTTGGG - Intronic
1185744363 X:2560143-2560165 ATAGTTGAATAGATGGTTATAGG + Intergenic
1191082452 X:56527802-56527824 CTAGAAGAAAACATCTTTTTTGG - Intergenic
1194599519 X:95903308-95903330 CTAAATGGATATATCTTTATTGG - Intergenic
1195636684 X:107124738-107124760 CAAGTTAAATAAATCATTATTGG - Intronic
1196112183 X:111958476-111958498 ATAATTCAATACATATTTATTGG - Intronic
1196233674 X:113254845-113254867 CTAGTTGTACTCATCTTTCTTGG + Intergenic
1196534438 X:116825482-116825504 CTAGTTTAATATCTCTTAATTGG - Intergenic
1197357856 X:125458702-125458724 CAAGTGTAATAAATCTTTATGGG - Intergenic
1197436548 X:126435527-126435549 GTTGTTGAATACATCTATTTGGG - Intergenic
1199004534 X:142679798-142679820 CTTGTTCAATATATATTTATGGG - Intergenic