ID: 962533073

View in Genome Browser
Species Human (GRCh38)
Location 3:136301526-136301548
Sequence CTGTGTGTGTGGAGGTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962533069_962533073 -9 Left 962533069 3:136301512-136301534 CCTAGAAGGTTGGACTGTGTGTG 0: 1
1: 0
2: 1
3: 18
4: 254
Right 962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG 0: 1
1: 0
2: 2
3: 24
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962533073 Original CRISPR CTGTGTGTGTGGAGGTCCGT GGG Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900464650 1:2819699-2819721 GTGTGTGTGTGCAGGTGCGTGGG - Intergenic
900524551 1:3122088-3122110 CGGTGTCTGTGGAGGTCAGGCGG + Intronic
900731318 1:4262958-4262980 CTGTGTGTGTGGGGGTGGCTGGG - Intergenic
901715059 1:11146783-11146805 GTGTGTGTGTATAGGTCAGTGGG - Exonic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
903835792 1:26202559-26202581 GTGTGTGTGTGCAGGCCCCTTGG - Exonic
904043205 1:27595898-27595920 GTGTGTGTGTGGAAGTGTGTGGG + Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
906606256 1:47174460-47174482 CAGTGTGTGTGGAGGGGCGTGGG - Intergenic
907563967 1:55417322-55417344 TTGTGTGTGTGTAGGTAGGTAGG + Intergenic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908106708 1:60852025-60852047 CTGTGTGTGTTGAGTTGTGTTGG + Intergenic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910578205 1:88791446-88791468 CTGTGTGTGTGGAGTTGCCCAGG + Intronic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
912269519 1:108194660-108194682 GTGTGTGTGTGTAGGTGCATGGG - Intronic
915319405 1:155047957-155047979 GTGTGTGTGTGCAGGTGTGTAGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
918010916 1:180585795-180585817 GTGTGTGTGAGGAGGTACCTTGG - Intergenic
918299575 1:183190501-183190523 CTGTGTGTGATGAGGTCTGGTGG - Intronic
918572228 1:186010209-186010231 GTGTGTGTGTGGGGGTACATGGG + Intronic
919930092 1:202215474-202215496 TTCTGTGTGTGGAGGTATGTGGG - Intronic
922471280 1:225878875-225878897 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
924081279 1:240400793-240400815 GTGTGTGTGTGGTGGTCGGGGGG - Intronic
1062831412 10:608358-608380 CTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062888490 10:1037825-1037847 CTGTGTGTGTGGAGGGGCTGGGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1063501938 10:6563322-6563344 CTGCATGTCTGGAGGTGCGTGGG + Intronic
1063727810 10:8658109-8658131 TTGTGTGTGTGGAGGGGTGTGGG + Intergenic
1063737677 10:8779069-8779091 CTCTGTGTGTGAAGGGCCATGGG - Intergenic
1067083303 10:43225238-43225260 GTCTGTGTGTGGGGGTCTGTGGG + Intronic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1069713940 10:70508809-70508831 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1069713946 10:70508847-70508869 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1072484109 10:95837990-95838012 CTGTGTGTGTGGGTGTGTGTGGG - Intronic
1073290512 10:102410968-102410990 CTGTGAGTTTGGAGGGCCCTTGG + Intronic
1073467685 10:103703883-103703905 CTGTGTGTGTGTAGCTGCCTAGG + Intronic
1073485149 10:103812552-103812574 ATGTGTGTGTCGGGGTCAGTAGG - Intronic
1073687763 10:105774817-105774839 CTGTGTGTGTGGACTTGGGTGGG + Intergenic
1074187785 10:111112144-111112166 CTGTGAGTGTGGAGGGTCCTTGG + Intergenic
1074713004 10:116193003-116193025 CTGTGTGTGTGGAGGGGCCTGGG - Intronic
1076256368 10:129028674-129028696 CCTTGTGTGTGGAGCTGCGTAGG - Intergenic
1077204093 11:1333382-1333404 CTGTGTGTGTGGTGTTTTGTAGG - Intergenic
1077528883 11:3086078-3086100 CTGTGTGTGTGAAGGTGCTGGGG + Intergenic
1077772030 11:5229707-5229729 GTGTGTGTGTTGTGGTCAGTGGG - Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078341450 11:10500381-10500403 CTGTGTGTTTTGAGGTGTGTGGG - Intronic
1078823475 11:14905655-14905677 CTCTGTGTGTGGAGGTGCCCTGG - Intronic
1079781596 11:24613302-24613324 GTGTGTGTGTGGATGTGCATGGG + Intronic
1081205192 11:40266952-40266974 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1081407325 11:42713095-42713117 CTGTTTGTATGGAGGTGCATTGG - Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1083188107 11:61029653-61029675 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1083256227 11:61497177-61497199 CTGTGTGTGTGGGTGTGTGTGGG + Intergenic
1083475068 11:62910125-62910147 CTGTATTTGGGGAGCTCCGTGGG + Exonic
1083997325 11:66278737-66278759 CTGTCTGTGTGTATGTCAGTCGG + Intronic
1084036020 11:66510853-66510875 ATGTGTGTCTGGAGGTCGCTCGG + Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085493822 11:76948253-76948275 GTGTGTGTGTGTAGGTGTGTAGG + Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1089583609 11:119496530-119496552 ATGTGTGTGTGGAGGGGCCTGGG + Intergenic
1089586766 11:119514592-119514614 CTGTGTGTGTTGAGGGGGGTAGG + Intergenic
1090154403 11:124422533-124422555 CTGTCTGTGTCTAGGTCCATGGG - Intergenic
1090641887 11:128736835-128736857 CTGTGTGTATGCAGGTGTGTGGG + Intronic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096749691 12:53751155-53751177 CTGTGCGTGCGGAGGCCTGTGGG - Intergenic
1096832708 12:54326669-54326691 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1097922072 12:65086617-65086639 CAGTGTGTGTGCAGGTACTTGGG + Intronic
1103217294 12:119211849-119211871 CTTTGGGTGGGGAGGTCCTTGGG - Intronic
1103324259 12:120109942-120109964 CTGTGTGTGTGGTGAGCCCTTGG + Intronic
1104969002 12:132522782-132522804 CAGTGTGTGTGCTGGGCCGTTGG + Intronic
1105423535 13:20273536-20273558 CTGTGGGTGTGGAGGTCCTGTGG + Intergenic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1108099418 13:46937898-46937920 GTGTGTGTGTGGTGGTGGGTTGG + Intergenic
1109463824 13:62700625-62700647 CAGTTTGTGTGGAGGTCCAGGGG - Intergenic
1111435528 13:88201500-88201522 GTGTGTGTGTGTAGGTGGGTGGG - Intergenic
1112401225 13:99080250-99080272 CTGTGTGTGTGTAGGCACTTAGG - Intronic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1117326991 14:54678505-54678527 GTGTGTGTGTGTAGGTCAGGTGG + Intronic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1119431725 14:74572732-74572754 GTGTGTGTGTGGCGGGGCGTGGG - Intronic
1119884048 14:78125364-78125386 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1120560115 14:85981013-85981035 GTGTGTGTGTGTAGGTGAGTTGG - Intergenic
1123920532 15:25066698-25066720 GTGTGTGTCTTGAGGTCCTTTGG + Intergenic
1124250893 15:28106067-28106089 ATGTGTGTGGGGAGTTCTGTGGG + Intergenic
1130088388 15:80797738-80797760 GTGGGTGTGTGGAGGACCCTGGG - Intronic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133832222 16:9333684-9333706 CTGTGTGTGTGGTGGCCCCTTGG + Intergenic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1134742582 16:16561066-16561088 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1134924979 16:18151386-18151408 GTGTGTGTGTGTAGGTAGGTTGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137698166 16:50476676-50476698 CAGTGTGTGTGCAGCTCCATAGG - Intergenic
1138515485 16:57533549-57533571 GTGTGTGAGTGCAGGTCCCTGGG - Intronic
1138515506 16:57533657-57533679 GTGTGTGAGTGCAGGTCCCTCGG - Intronic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1140046700 16:71444286-71444308 CTGTGTATGTGGAGGTCTATGGG + Intergenic
1140105398 16:71955270-71955292 GTGTGTGTGTGGAGGTGCAGTGG + Intronic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140954644 16:79850798-79850820 GTGTGTGTGTGTAGGTGTGTAGG - Intergenic
1143334575 17:6162691-6162713 GTGTGTGTGTGGGGGTGGGTGGG - Intergenic
1143498048 17:7323613-7323635 CTGTGTGTGTTGGGGGCTGTTGG - Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144591882 17:16531334-16531356 GTGTGTGTGTGGGGGTGGGTGGG - Intergenic
1145032015 17:19511430-19511452 CTGTGTGAGTGGGAGTCTGTGGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1147425669 17:40344905-40344927 TTGGGTGTGTGGAAGTCCGCTGG + Intronic
1147650161 17:42057530-42057552 GTGTGTGTGTGATGGTCCATAGG + Intronic
1148686103 17:49502093-49502115 CTGTGTGTGTACAGGCCTGTGGG - Exonic
1150409863 17:64934381-64934403 CTGTGCCTGTGGAAGTCCCTTGG - Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1152304112 17:79511270-79511292 CTGTGTGTGTGCAGTGTCGTGGG + Intronic
1152426905 17:80222961-80222983 GTGTGTGTGTGTAGGTGGGTGGG + Intronic
1153245914 18:3072690-3072712 GTGTGTGTGTGGGGGGCGGTGGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1155318904 18:24598983-24599005 CTGTGTGTTTAGAGGTTGGTTGG - Intergenic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1159438516 18:68447984-68448006 CTGTGAGAGTGGAGGTCCTTGGG - Intergenic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1160496464 18:79378905-79378927 CTGTGTGCGTGGGGTTCCGAAGG + Intergenic
1160966047 19:1747406-1747428 GTGTGTGTGTGGCGGGCGGTGGG - Intergenic
1161062831 19:2223548-2223570 CTGTGTGTGTGTGGGTGGGTGGG + Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161596531 19:5153757-5153779 CTGGGTGTGTGGGGGTGTGTTGG - Intergenic
1162015266 19:7842163-7842185 CTGTGTGTGTGAATGTGCATGGG + Intronic
1162401928 19:10451681-10451703 GTGTGTGTTTGCAGGGCCGTAGG + Intronic
1162829136 19:13273319-13273341 GTGTGTGTGTGGGGGTGCGGCGG + Intronic
1164745645 19:30610754-30610776 GTGTGTGTGTGGAGGCGGGTGGG + Intronic
1165406495 19:35634074-35634096 CTGTCTGTGTGGAAGTTCCTGGG - Intronic
1166332550 19:42087518-42087540 GTGTGTGTGTGGGGGTGGGTAGG - Intronic
1166766251 19:45253176-45253198 GTGTGTGTGGGGGGGTCTGTCGG - Intronic
1167449136 19:49556802-49556824 CTGTGCGTGAGGAGGACGGTGGG + Intronic
1168241197 19:55089714-55089736 CTGTGTGTGTGGAGGCCCTGGGG - Intergenic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926245334 2:11118963-11118985 CTTAGTGTTTGGAGATCCGTAGG - Intergenic
926743394 2:16130666-16130688 GTGTGTATGTGTAGGTGCGTAGG - Intergenic
928661066 2:33502286-33502308 TTCTGTGTGTGGAGGTGGGTGGG + Intronic
929665120 2:43827915-43827937 CTGTGTGTGTGCAGATACTTTGG - Intronic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
929928818 2:46236352-46236374 CTGTGTGTGGGTTGGTCTGTGGG + Intergenic
931251116 2:60531228-60531250 GTCTGTGTGTGCAGGACCGTCGG - Intronic
934752436 2:96801996-96802018 CTGTGTGTGTGTGTGTCCATGGG - Intronic
938378638 2:130824394-130824416 ATGTGTGTGTGCAGGCCCTTTGG - Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940266529 2:151844709-151844731 CTGAGTCTGTGGATGTCCTTTGG - Intronic
941427762 2:165369654-165369676 GTGTGTGTGTGGAGGCGGGTGGG - Intronic
942121433 2:172781731-172781753 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943422164 2:187679384-187679406 GTGTGTGTGTGTAGGTGCATGGG - Intergenic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
948297805 2:236875937-236875959 CTGTGTGTCTGGAAGCACGTTGG - Intergenic
948558419 2:238834260-238834282 GTGTGTGTGTGTAGGTAGGTAGG - Intergenic
948598826 2:239096727-239096749 GTGTCCGTGTGGATGTCCGTGGG - Intronic
948867019 2:240780759-240780781 GTGTGTGTGTGGAGCTGTGTGGG - Intronic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1169293593 20:4373618-4373640 GTGTGTGTGTGGAGGTGTATGGG + Intergenic
1170153321 20:13247548-13247570 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1170573173 20:17643861-17643883 ATGTGTGTGGGGAGGGGCGTGGG - Intronic
1171216313 20:23355047-23355069 GTGTGTGTGTGGTGGTGGGTAGG + Intergenic
1171963653 20:31513978-31514000 CAGTGTGTGTGGGGGGACGTTGG - Intergenic
1172390920 20:34564817-34564839 CTGTGTGTGTGGAAATCTGGAGG + Intronic
1173522691 20:43711420-43711442 CTGTGTGTGTGTGGGACTGTGGG - Intronic
1174367429 20:50065018-50065040 GTGTGTGTGTGGGGGTGTGTAGG - Intergenic
1174482015 20:50837957-50837979 GTGTGTGTGTAGAGGTGGGTGGG - Intronic
1174987935 20:55476351-55476373 ATTTGTGTGTGGAGGTGGGTTGG + Intergenic
1175172573 20:57090856-57090878 GTGTGTGGGTGGAGGTGTGTGGG - Intergenic
1175393106 20:58639674-58639696 CTGTGTGTGTGTGTGTGCGTTGG - Intergenic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1175978109 20:62723708-62723730 CTGTGTCTGAGGAGGTCCCTGGG - Intronic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1178153968 21:29830294-29830316 GTGTGTGTGGGGAGGTGGGTGGG - Intronic
1179679759 21:43010944-43010966 CAGTGTTTGTAAAGGTCCGTAGG + Intronic
1179939583 21:44628933-44628955 CTGGGTGGGTGGAGGGCCGGTGG + Intronic
1182621216 22:31619820-31619842 CTGTTTGTGTGCAGGTCCTGTGG + Exonic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183062234 22:35343321-35343343 GTGTGTGTGTGGGGGTGTGTAGG - Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1183720919 22:39560806-39560828 GTGTGAGTGTGCAGGTCTGTGGG + Intergenic
1184376592 22:44117359-44117381 CAGTGAGTGTGGGGGTCTGTGGG + Intronic
1184507473 22:44913266-44913288 CTGGGTGTGTGCAGGACCCTGGG - Intronic
1185078447 22:48695930-48695952 CTGTCTGTGTGGTGGTCAGCAGG - Intronic
1185259847 22:49855434-49855456 CTGTGTGTGTGGAGGGGGTTGGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
950636365 3:14317988-14318010 GTGTTTGTGTGGAGGTCGGGAGG + Intergenic
950688224 3:14634350-14634372 CTGTATGTGGGGAAGTCCATGGG - Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953331990 3:42061346-42061368 GTGTGTGTGTGGGTGTGCGTGGG - Intronic
953369300 3:42373555-42373577 ATGTGTGTGTGCAGGTCCTTGGG + Intergenic
953457836 3:43056693-43056715 GTGTGTGTGTAGAGGTGTGTAGG + Exonic
953617355 3:44503145-44503167 CAGTGTGTGTGGAGGTGCCTGGG - Intronic
953625545 3:44567801-44567823 CAGTGTGTGTGGAGGTGCCTGGG + Intronic
954581545 3:51705920-51705942 ATGTGCGTGTGGCAGTCCGTAGG - Intergenic
954817431 3:53293921-53293943 GTGTGTGTGCGGGGGTCCGGTGG - Intronic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955056588 3:55460762-55460784 CTGTGAGTCTGGAGGTTCATGGG - Intergenic
955230576 3:57095674-57095696 CTGTGTGTGCTGAGGTCCTGGGG + Exonic
955638848 3:61059990-61060012 GTGTGTGTGTGTAGGTGTGTAGG + Intronic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
960291078 3:115885623-115885645 TTGTGTGTGTGGGGGTGGGTGGG + Intronic
960947101 3:122974286-122974308 CTGTGTGTGTGCAGGAGCGAGGG - Intronic
961043962 3:123696144-123696166 CTGTTTGGGTGGGGGTCTGTGGG + Intronic
961477165 3:127155593-127155615 TTGTGTGTGTGTAAGTCTGTGGG + Intergenic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
964008992 3:151866951-151866973 TTCTGTGTTTGGAGGTCCTTTGG + Intergenic
965947126 3:174256555-174256577 GTGTGTGTGTGGCGGTGTGTTGG + Intronic
967981243 3:195066534-195066556 CTGCCTGTGTGGTGATCCGTCGG + Intergenic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969325074 4:6438945-6438967 GTGTGTGTGTTGAGGTCCTTGGG - Intronic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
972600076 4:40564384-40564406 ATGTGTGTGTGCAGGTTCGGGGG - Intronic
974795546 4:66744515-66744537 GTGTGTGTGTGGAGGTGGGTGGG - Intergenic
978172802 4:105694292-105694314 CTGTGTGTGTGTATATCCTTTGG - Intronic
979591973 4:122491181-122491203 CTTTTTTTGTGGAGGTCAGTGGG + Intergenic
980869066 4:138589827-138589849 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
982893558 4:160887198-160887220 GTGTGTGTGTGTGTGTCCGTGGG + Intergenic
983269933 4:165549454-165549476 CTGCGTCTGTGGAGGCCAGTGGG + Intergenic
983919887 4:173334113-173334135 CTGGGTCTGTGGAGGGCCGGCGG - Intronic
984374992 4:178918406-178918428 GTGTGTGTGTGTAGGCACGTTGG - Intergenic
985161259 4:187047251-187047273 CTGTGTGTGCGGGGGTGGGTGGG + Intergenic
985516001 5:344908-344930 AGGTGTGTGTGGAGGGCTGTGGG + Intronic
985779109 5:1860587-1860609 CTGTGTGTGAGGGGGTCACTGGG + Intergenic
986335307 5:6750617-6750639 GTATGTGTGTGGAGGTGGGTGGG + Intronic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
986799725 5:11246705-11246727 CTGTGTGTCTGTAGGTGGGTGGG + Intronic
987207468 5:15642338-15642360 CTGTGTGTGTGGGGTACCCTTGG - Intronic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991040121 5:62166846-62166868 CTGTGTGTGTGGAGGTGGGTGGG - Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
992530829 5:77650349-77650371 GTGTGTGTGTGGAGGTACAAGGG + Intergenic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
994938935 5:106294505-106294527 ATTTGTGTGTGGAGGTGGGTCGG + Intergenic
997024024 5:130036781-130036803 CTGTGTGTGTGGCTGTGGGTGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999241194 5:150128406-150128428 CTCTGTGTATGCAGGTCCCTGGG - Intronic
999251655 5:150185951-150185973 CAGAGTGTGTGGAGTTCAGTGGG - Intergenic
999474091 5:151882049-151882071 CTGTGTGTGTGTGTGTCCATGGG + Intronic
1001108686 5:168877295-168877317 CTGGCTGTGTGGAGGTCTGAGGG + Intronic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1002467768 5:179416336-179416358 CTGGGTGTGGGGAGGGGCGTGGG - Intergenic
1002633285 5:180594787-180594809 GTGTGTGTGTGAGGGTGCGTGGG + Intergenic
1004297293 6:14424762-14424784 GTGTGTGTGTGTAGGTGTGTAGG - Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006626766 6:35403138-35403160 TTCTGTCTGTGGAGGTCCCTTGG + Intronic
1007964838 6:45994729-45994751 CTCTGTCTCTGTAGGTCCGTGGG - Intronic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1011233901 6:85193626-85193648 GTGTGTGTGTGTATGTCTGTTGG - Intergenic
1012640936 6:101612742-101612764 GTGTGTGTGTGTAGGTACATAGG + Intronic
1013141338 6:107338713-107338735 CAGTATGTGTGGAGGTCCGAAGG + Intronic
1013929531 6:115514482-115514504 CTGTGTATATAGAAGTCCGTAGG - Intergenic
1014320565 6:119923889-119923911 ATGTCTGTGTGGAAGTCTGTTGG - Intergenic
1015895098 6:138009336-138009358 CTGTTTGTCTGCAGGTGCGTAGG + Intergenic
1016394939 6:143613836-143613858 CTTTGTGTGTGGAGGTGGGTTGG - Intronic
1017048977 6:150372686-150372708 ATGTGTGTGTGGGGGTGTGTTGG + Intronic
1018377116 6:163223491-163223513 CATTGTGTGTGGAGCTCAGTGGG - Intronic
1018431418 6:163725734-163725756 CTGAGTGTGTGGAGGCCCAGCGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019135844 6:169907198-169907220 GTGTGTGTGTGCAGGTACGCAGG - Intergenic
1019407733 7:892580-892602 AGGTGTGTGTGCAGGTCTGTTGG + Intronic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019771678 7:2887213-2887235 CTGTGTGAGTGTGTGTCCGTCGG - Intergenic
1027318310 7:76997672-76997694 TGGGGTGTGTGGAGGTGCGTGGG + Intergenic
1027318427 7:76998192-76998214 GTGGGTGTGTGGAGGTGTGTGGG + Intergenic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1029423840 7:100484760-100484782 GTGTGTGTCTGGAGGTCTGTGGG + Intronic
1029550927 7:101236738-101236760 CGGTGTGTGTGCAGGTGTGTGGG - Intronic
1030112469 7:106038495-106038517 GTGTGTGTGTGGTGGTGAGTGGG + Intergenic
1030395538 7:108981579-108981601 CTGTGTATGTGGAGGTGGGGTGG + Intergenic
1030820452 7:114086223-114086245 CTGTGTGTGTGAATGTGCGCTGG - Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1034264724 7:149775311-149775333 CTGAGTGTGTGGAGATGCGTGGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034470102 7:151250332-151250354 CTCTGTGTGTGGGGGTGTGTGGG - Intronic
1034589971 7:152130786-152130808 CTGTCTGAGTGGGGGTCCGCAGG + Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1034976267 7:155450672-155450694 CCGGGTGGGTGGAGGTGCGTGGG - Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035319792 7:158021469-158021491 CTGTGTGTGTGCGTGTGCGTGGG - Intronic
1036125391 8:6057452-6057474 CTGTGTGTGTGGTGGTGCAAGGG - Intergenic
1039224056 8:35368352-35368374 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1041326669 8:56674031-56674053 GTGTGTGTGTGAAGGTGGGTGGG + Intergenic
1041723548 8:60997968-60997990 GTGTGTTTGTGGAGGACGGTGGG + Intergenic
1045814812 8:106267545-106267567 AAGTGTGTTGGGAGGTCCGTTGG - Intergenic
1046109146 8:109700775-109700797 ATGTGTGTGTGGAGATGGGTGGG + Intergenic
1046792161 8:118333862-118333884 CTGTGTGTGTGTGTGTGCGTTGG + Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047740046 8:127799113-127799135 GTGTGTGTGTGGAGTTAGGTGGG + Intergenic
1049824418 8:144659145-144659167 CTGTTTGTGTCGAGTTCCCTGGG - Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1052409484 9:28104895-28104917 TTGTGTGTGTGTGGGTCGGTGGG - Intronic
1053114691 9:35490407-35490429 CTGGGTGTTTGAAGGTCCGGTGG - Intronic
1053165573 9:35841567-35841589 TGGTGTGTGTGGGGGGCCGTGGG + Exonic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1055395591 9:75870569-75870591 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1061483522 9:130908884-130908906 CTGTGTGCATGGAGGCCCCTGGG - Intronic
1061912435 9:133732291-133732313 CTGTGAGGGTGGAGGTACGCTGG - Intronic
1061935301 9:133854177-133854199 TTGTGTGTGTGCAGGTACATGGG - Intronic
1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187626500 X:21120645-21120667 CTGTGTGTGTGGAGGAGCAGAGG - Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188370020 X:29358404-29358426 CTGTGTGTGTGGCGGGGGGTGGG - Intronic
1189074724 X:37904248-37904270 GTGTGTGTGGGGTGGTCCGGGGG + Intronic
1189118248 X:38366022-38366044 ATGTGTTTTTGGAGGTCCTTTGG - Intronic
1194449382 X:94025760-94025782 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1194608864 X:96015684-96015706 ATGTGTGTGTGGAGGGGGGTGGG - Intergenic
1194821691 X:98515316-98515338 GTGTGTGTGTGTAGGTGTGTAGG + Intergenic
1195906905 X:109852967-109852989 CTGTGTGTGGGGAGATGCGGGGG - Intergenic
1199972699 X:152872564-152872586 GTGTGTGTGTGGGGGTGTGTGGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic