ID: 962536087

View in Genome Browser
Species Human (GRCh38)
Location 3:136329790-136329812
Sequence TTGGGCACTGCTTATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962536079_962536087 25 Left 962536079 3:136329742-136329764 CCTGGGATACAAGGGGGAATTCA 0: 1
1: 0
2: 1
3: 6
4: 134
Right 962536087 3:136329790-136329812 TTGGGCACTGCTTATACTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 103
962536083_962536087 -3 Left 962536083 3:136329770-136329792 CCTACCATCTCTGTATCAGGTTG 0: 1
1: 0
2: 0
3: 17
4: 122
Right 962536087 3:136329790-136329812 TTGGGCACTGCTTATACTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 103
962536086_962536087 -7 Left 962536086 3:136329774-136329796 CCATCTCTGTATCAGGTTGGGCA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 962536087 3:136329790-136329812 TTGGGCACTGCTTATACTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962536087 Original CRISPR TTGGGCACTGCTTATACTGC TGG Intronic
902216114 1:14935469-14935491 TCGGGCACTGCTGATGTTGCTGG - Intronic
903803397 1:25986901-25986923 CTGGGCACTGCTTTGAGTGCTGG + Intronic
905832967 1:41089074-41089096 CTGGGCAGTGCTGATGCTGCTGG + Intronic
907695227 1:56719034-56719056 TTGGGCACTTCTTAAAATGATGG + Exonic
907835471 1:58104426-58104448 GTGGGCACTGTGGATACTGCTGG + Intronic
916857288 1:168763256-168763278 TTAGTCATTTCTTATACTGCAGG - Intergenic
917257219 1:173128641-173128663 TGGGGCACTACTTACCCTGCAGG - Intergenic
917935686 1:179864653-179864675 TTGGGAACTGCTTAAATTGTTGG - Intronic
920050958 1:203164858-203164880 TTGGGCAGTCCTCATTCTGCCGG + Intronic
922500562 1:226094332-226094354 ATGGGCATTGCTTTTGCTGCTGG - Intergenic
923895506 1:238265235-238265257 TTAGGAACTTCATATACTGCTGG + Intergenic
1065125491 10:22569574-22569596 TTGAGCACTGCCTATGATGCTGG + Intronic
1068371408 10:56120997-56121019 TTGGGCACTGCTTGAATGGCTGG - Intergenic
1071347047 10:84702588-84702610 ATGGGCACTGCCCATGCTGCAGG + Intergenic
1079063647 11:17271410-17271432 TTGGGTACAGTGTATACTGCTGG - Intronic
1079281476 11:19090733-19090755 TGGAGCACTGGTTAGACTGCTGG - Intergenic
1079414183 11:20217679-20217701 CTGGGCACTGCTTACATTGGTGG - Intergenic
1082964802 11:58956118-58956140 TTGGGCACTTATAATACAGCAGG + Exonic
1083367523 11:62150465-62150487 TTGGGCATGGCATATGCTGCTGG + Intronic
1086174905 11:83879735-83879757 TTGGGCACTTATTATACACCAGG + Intronic
1086533626 11:87815841-87815863 TTGGCCAAGGCTTATACTACAGG - Intergenic
1086844593 11:91732547-91732569 TTTAGCAGTTCTTATACTGCTGG - Intergenic
1087681468 11:101223026-101223048 TTGGGCACTTCTTGTAAGGCTGG + Intergenic
1093063638 12:14633063-14633085 TAGGCCACTGCTGCTACTGCTGG + Intronic
1096759835 12:53831990-53832012 TTGAGCCCAGCTCATACTGCAGG + Intergenic
1097705456 12:62864025-62864047 TAGAGCACTGGTTCTACTGCAGG + Intronic
1098029403 12:66238729-66238751 ATGGGCACTGCTTCTCCTGTGGG - Intronic
1098530762 12:71539077-71539099 TTAGGCAGTGCTGATGCTGCTGG - Intronic
1099622276 12:85018935-85018957 TTGGGCACTTATTATATTCCAGG + Intronic
1102258090 12:111427809-111427831 TTGGGCTTTCCTTATACAGCAGG + Intronic
1104741860 12:131183238-131183260 TTATACACTGCTTACACTGCTGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1109450892 13:62512840-62512862 TTGGGCACTGGTTGTGCTGGGGG + Intergenic
1109837377 13:67877459-67877481 TTAGGCACTTCTGATACTGTGGG - Intergenic
1111026485 13:82533948-82533970 TTTAGCAGTTCTTATACTGCAGG - Intergenic
1113240785 13:108334848-108334870 TTGGGTACAGTGTATACTGCTGG + Intergenic
1114375452 14:22141550-22141572 GTGGGGACTGCTTATATTGTAGG - Intergenic
1114423306 14:22602501-22602523 TGGGGCAGTGCTTGTTCTGCTGG - Intronic
1116167900 14:41357313-41357335 TTTGGCAATGCTTAAACTTCAGG + Intergenic
1118614944 14:67568867-67568889 TTGGGCACTGATTATATTCCAGG + Intronic
1119924445 14:78479434-78479456 TTGGGTGATGCTGATACTGCTGG + Intronic
1121019847 14:90573234-90573256 TTGGGGAATGCTCATCCTGCAGG + Intronic
1121618361 14:95329123-95329145 TTGGGCAGTTCTTATGCTGCTGG + Intergenic
1122116488 14:99530131-99530153 GTGGACACTCCTTACACTGCTGG + Intronic
1123030027 14:105447225-105447247 CTGGGCACTGCTTCTCCAGCGGG - Intronic
1132004206 15:98211900-98211922 TTGGACACTGGCTATAGTGCTGG + Intergenic
1132006804 15:98234845-98234867 CTGGGCACTGCTGATAATGGGGG - Intergenic
1159506495 18:69343854-69343876 TTTGTCACTTCTTATACTTCAGG - Intergenic
1160260705 18:77291552-77291574 TTGGGACCTTCATATACTGCTGG + Intergenic
1161952638 19:7476455-7476477 GAGGGCACTGCTTAGTCTGCTGG - Intergenic
1166665895 19:44680313-44680335 TTGGGCCCTGCTCATGATGCTGG + Exonic
931890111 2:66662061-66662083 TTGGGCACTCCTTGTTCTCCTGG - Intergenic
934832986 2:97551129-97551151 TTGGGTTATGCTGATACTGCTGG - Intronic
936267191 2:111019682-111019704 TTGGGGTCTGTTTATATTGCCGG + Intronic
941303757 2:163835098-163835120 TTGGGCAATGCTTATTTTGTTGG - Intergenic
942595114 2:177585171-177585193 TTGGGCCCTCCTTGGACTGCGGG + Intergenic
943693933 2:190902524-190902546 TTGGGAATTGCTTACATTGCAGG + Intronic
944821906 2:203440482-203440504 TTGGGCTTTGCTTTTACTGCAGG + Exonic
946011905 2:216572136-216572158 TTGGGCACTGCCTAAACTTCAGG + Intronic
1172013349 20:31859178-31859200 TGGGGCACTGCTTAGGCTCCCGG - Intronic
1173187998 20:40856094-40856116 TTGGGCACTGTTTCTAGTACTGG - Intergenic
1173297122 20:41769604-41769626 TTGGCCACTTCTTAAACTGAAGG + Intergenic
1173760063 20:45552082-45552104 ATGGGCACTCCTCATCCTGCAGG + Exonic
1175325953 20:58128767-58128789 ATGGGCACTGCTTCTCCTGCTGG - Intergenic
1177373669 21:20239875-20239897 TTAGGCAATTCTTATAGTGCTGG + Intergenic
1179730651 21:43365555-43365577 TTGGGCACTGCTTGGTCTTCAGG - Intergenic
1181867527 22:25870691-25870713 TTGGGCGATGCTGATGCTGCTGG - Intronic
957705228 3:83771212-83771234 TTATACACTGATTATACTGCAGG - Intergenic
959847513 3:111051468-111051490 TTGGGCATTGTTTCTGCTGCTGG + Intergenic
961390124 3:126547634-126547656 CTGGGCCCTGCCTATAGTGCAGG + Intronic
962536087 3:136329790-136329812 TTGGGCACTGCTTATACTGCTGG + Intronic
962869624 3:139476697-139476719 TAGGGCCCTGCTTATGGTGCAGG - Intronic
963580728 3:147123613-147123635 TTGGGCACTTCTTAAAATGATGG + Intergenic
965064468 3:163829099-163829121 TGCGGCACTGCTTATACAGAGGG - Intergenic
967196034 3:187026364-187026386 TTGGGCACTGTTGTTGCTGCAGG + Intronic
967570087 3:191018233-191018255 TTGGGTACAGTGTATACTGCTGG - Intergenic
968737703 4:2305926-2305948 TTGGGCACTGGCTATGCAGCAGG + Intronic
982842768 4:160212977-160212999 TTAGCCACTGCCTATACTTCCGG + Intergenic
984234462 4:177138873-177138895 TTGAGCAGTTCTTATAGTGCTGG - Intergenic
991035352 5:62122746-62122768 TTAGGAACTGCCTATACTGTAGG - Intergenic
993796831 5:92277484-92277506 TTTGGCATTTCTTATAGTGCTGG - Intergenic
995230488 5:109755902-109755924 TTGGGCTCTGCTTGTTTTGCTGG + Intronic
996863995 5:128097848-128097870 TTGGGCACTTCTTGTAATGGAGG + Intronic
997948618 5:138224133-138224155 TTGGTCATTGTCTATACTGCTGG - Intergenic
1000158886 5:158580329-158580351 TTGAGCAGTTCTTATAGTGCTGG + Intergenic
1003244637 6:4373619-4373641 ATGGGCCCTGCTCATGCTGCTGG + Intergenic
1004454211 6:15776628-15776650 ATGGGCACTGCATATTATGCAGG + Intergenic
1008563266 6:52742928-52742950 TTGGTCATTGGTAATACTGCAGG + Intergenic
1009644589 6:66381847-66381869 TTTGGCATTTCTTATAGTGCTGG + Intergenic
1020358411 7:7302074-7302096 TTTGGCAGTTCTTATAGTGCTGG + Intergenic
1025848827 7:65225599-65225621 TTGGGTACAGCATACACTGCTGG - Intergenic
1027691538 7:81353038-81353060 TTTAGCAGTGCTTATAGTGCTGG + Intergenic
1030114291 7:106051323-106051345 TTGAGTACCTCTTATACTGCAGG + Intergenic
1030394776 7:108972206-108972228 CTGGGCATTGCTTAGACAGCTGG - Intergenic
1033433397 7:141309835-141309857 ATGGGTACTGCATATACTTCTGG - Intronic
1036553319 8:9834504-9834526 ATGGGTAGTGCTTCTACTGCAGG + Intergenic
1037943700 8:22973592-22973614 CTGGGCACTGCTGATACAGCTGG - Intronic
1046061907 8:109150410-109150432 TTGAGCACTGCTTTTGGTGCTGG + Intergenic
1046721972 8:117630576-117630598 TTGAGCACAGCTGATATTGCAGG + Intergenic
1048815915 8:138333495-138333517 ATGGGCAATGCCTATTCTGCTGG - Intronic
1049991372 9:994864-994886 TTTGGCACTGCTGATCCTTCCGG + Intergenic
1050004839 9:1119201-1119223 TTGGTCACTGCTTAGCCTGTAGG - Intergenic
1060668326 9:125446887-125446909 TTGGGCTCTGCTTAAAGTGCAGG - Intronic
1186248965 X:7645547-7645569 CTGGTCACTGCTTGTCCTGCTGG - Intergenic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1189550363 X:42086394-42086416 TTGGACACACCTGATACTGCAGG - Intergenic
1190808830 X:53864317-53864339 TTGAGCACTGGTTGTACTGAGGG - Intergenic
1195405339 X:104506639-104506661 TTGAACATTTCTTATACTGCAGG + Intergenic
1195800207 X:108700384-108700406 ATGGTCACTGCTTATTCTCCTGG - Intergenic
1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG + Intergenic
1202091181 Y:21192531-21192553 ATGGGCAGTGTTTATACAGCAGG - Intergenic