ID: 962536918

View in Genome Browser
Species Human (GRCh38)
Location 3:136337626-136337648
Sequence CCATATCCACAGAGGGTGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962536912_962536918 16 Left 962536912 3:136337587-136337609 CCTTTTATTCAAGAGTATATAAA 0: 1
1: 0
2: 5
3: 37
4: 495
Right 962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962536918 Original CRISPR CCATATCCACAGAGGGTGTG TGG Exonic
900786322 1:4652966-4652988 CCATAGCCACAGTGTGTGTAAGG + Intergenic
902531206 1:17091887-17091909 ACATATCCACAGACAGGGTGAGG + Intronic
902621379 1:17652847-17652869 CCAGACCCACAGGGGGTCTGTGG + Intronic
904679236 1:32217161-32217183 CCATCTCCCCAGAGTGGGTGAGG - Intronic
904909902 1:33927033-33927055 TCATTTCCACAGAGGCTGAGGGG - Intronic
907308917 1:53528400-53528422 CCCTGTCCACAGCAGGTGTGTGG - Intronic
914867537 1:151444190-151444212 CCAAAGCCACAAAGGGGGTGAGG + Intronic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
916424699 1:164669418-164669440 CCAAATCCACAGAGGACATGGGG + Intronic
916934211 1:169611006-169611028 CCTTATAAACTGAGGGTGTGAGG + Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
920832623 1:209479129-209479151 CCATATCCTGAGATGATGTGGGG + Intergenic
922787818 1:228291907-228291929 CCAAGTTCACAGAGGGTCTGAGG + Exonic
922788949 1:228299268-228299290 CCAGGTTCACAGAGGGTCTGAGG + Exonic
924232763 1:241976224-241976246 CCAAAGTCACAGAGGGAGTGGGG + Intergenic
1063135014 10:3208724-3208746 CCACACACACAGAGGATGTGGGG - Intergenic
1064547822 10:16468523-16468545 CTTTATCCACAAAGGGTTTGAGG - Intronic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1069182724 10:65383309-65383331 CCTTATCCACAGAGGATATGTGG - Intergenic
1069636650 10:69929264-69929286 CCAGACCCACAGCGGGAGTGAGG + Intronic
1069790166 10:71014381-71014403 CCATAACCTCAGAGGGACTGTGG - Intergenic
1072596708 10:96879442-96879464 CCATCTCCACACAGAGTTTGTGG + Intronic
1073379896 10:103070140-103070162 CCATGTTCACAGTGGGTGTTGGG - Intronic
1075737924 10:124675406-124675428 CCAGAGCAGCAGAGGGTGTGGGG + Intronic
1076508924 10:130998582-130998604 CCATTCCCACTGAGGGTGTGAGG + Intergenic
1076725575 10:132411425-132411447 CCACATCCCCAGCGGTTGTGTGG + Intronic
1077481513 11:2816973-2816995 CCCTGTCCGCAGAGGGTGTCAGG + Intronic
1079312502 11:19378977-19378999 CCAAAACCACACAGGGAGTGAGG - Intronic
1080320447 11:31003294-31003316 CTATTTCCACCGAGGGAGTGGGG + Intronic
1083581007 11:63825382-63825404 CCACAGACACAGAGGGAGTGAGG - Intronic
1084608984 11:70188807-70188829 GCATTTCCACAGATGGTGTCAGG + Exonic
1085023063 11:73221207-73221229 CCATCTCTGCAGAGGGGGTGGGG - Intronic
1086079739 11:82890718-82890740 CAATTTCCTCAGAGGGTGAGTGG - Intronic
1086293537 11:85338677-85338699 ATTTATACACAGAGGGTGTGTGG - Intronic
1087066991 11:94036573-94036595 CCAGATCCACAGTGAGTGTCAGG - Intronic
1087831122 11:102820688-102820710 ACATATCCTCTGAGGGTCTGTGG + Intergenic
1088975571 11:114813343-114813365 CCATGTCCACAGAAGGCCTGAGG + Intergenic
1092053439 12:5489846-5489868 CAGCATCCACAGAGGGTTTGGGG - Intronic
1099101324 12:78444684-78444706 CCATATCCATAGGGGTTGAGAGG - Intergenic
1099604187 12:84781015-84781037 ACATATCTACAGAGGGGTTGGGG - Intergenic
1102466771 12:113134925-113134947 CCAGATCCACACAGGATGTTAGG + Intronic
1104428415 12:128696697-128696719 CCATTTCCACATATGGTGTAAGG - Intronic
1104903444 12:132201427-132201449 TAATATCCACAGAGGGTCTGAGG + Intronic
1113139092 13:107127339-107127361 CCTTATCCACAGAGGCAGTGTGG - Intergenic
1113778531 13:112962738-112962760 CCCTACCCAGAGAGGGTATGAGG + Intronic
1114724617 14:24922311-24922333 CCAAAGCCACAGAGTGAGTGGGG + Intronic
1114790397 14:25651328-25651350 CCATATGCATGGAGGGTGAGGGG - Intergenic
1121224261 14:92309660-92309682 AAATGTCCACAGAGTGTGTGAGG - Intergenic
1122291530 14:100682808-100682830 GCATATCTTCAGAGTGTGTGTGG - Intergenic
1124105024 15:26729586-26729608 CCACATCCACAGAGAATTTGGGG - Intronic
1129048192 15:72755797-72755819 CCTTGTCCACAGAGGTGGTGGGG - Intronic
1130088393 15:80797749-80797771 CCAGGTCCACCGTGGGTGTGTGG - Intronic
1130323012 15:82855712-82855734 CCATATCCCCCCGGGGTGTGAGG + Intronic
1132229989 15:100174719-100174741 CAAAATCCAGAGAGGGTTTGAGG - Intronic
1134087564 16:11368559-11368581 CAATATCAAGAGGGGGTGTGTGG - Intronic
1137484955 16:48882955-48882977 CCACATCCACTGGAGGTGTGGGG - Intergenic
1137984825 16:53099032-53099054 CACTACCCACAGAGGGTGGGTGG + Intronic
1141790196 16:86229189-86229211 CAATAACCAGAGTGGGTGTGAGG - Intergenic
1143532136 17:7511713-7511735 CCAGATCCAGGGAGGGTGTCAGG - Intronic
1143573124 17:7773469-7773491 ACATATCCCCAGTGGGTGGGGGG - Intronic
1146277546 17:31524966-31524988 GCATGTCCACTGAGGGCGTGTGG - Intronic
1147178989 17:38673428-38673450 CCACCTCCACAGCGGGTGGGCGG + Exonic
1147514655 17:41104371-41104393 ATATATACACTGAGGGTGTGTGG + Intronic
1147537019 17:41327850-41327872 CTATCTCCACAGTGGGTGAGAGG - Intergenic
1151850217 17:76685564-76685586 CAATAGCCACAGGGGGTGGGGGG - Intronic
1153026908 18:680595-680617 CCATTGAGACAGAGGGTGTGTGG - Intronic
1160033691 18:75282759-75282781 CCATATCCGCATACGGTATGTGG + Intronic
1160033692 18:75282765-75282787 CCATATCCACATACCGTATGCGG - Intronic
1162368044 19:10261303-10261325 CTATGTCCACTGAGGGTGTTTGG - Intergenic
1162967733 19:14164006-14164028 CCATACCCACTGTGGGTGTCAGG + Intronic
1163612392 19:18308259-18308281 CCAGGCACACAGAGGGTGTGGGG - Intronic
1163751135 19:19078478-19078500 CCATATGCACAGAGTCTATGTGG - Intronic
1163790598 19:19303920-19303942 CCACAACGACAGAGGGGGTGGGG + Intronic
1164965334 19:32478251-32478273 CCATATCCACTAAGGACGTGAGG + Intronic
927128356 2:20034501-20034523 CCTTCTACACAGAGGATGTGTGG - Intronic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
931873953 2:66491764-66491786 CTACATTCACAGAGTGTGTGGGG + Intronic
933629430 2:84639131-84639153 CCATGCCCACAGTGGGTATGGGG - Intronic
933646299 2:84815327-84815349 CCAAATCCACTCAGGGTTTGAGG + Intronic
933848887 2:86349685-86349707 CTATGCCCAAAGAGGGTGTGTGG - Intergenic
935602138 2:104933571-104933593 CAAAATCCACTGAGAGTGTGGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937427408 2:121811864-121811886 CCAGACCCACAAAGGGTGTAAGG - Intergenic
942381308 2:175394145-175394167 CCTTGTACACAGAAGGTGTGTGG + Intergenic
944934290 2:204551584-204551606 GATTATACACAGAGGGTGTGTGG - Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
946121629 2:217520874-217520896 CCATATTCTCAGTGGCTGTGTGG + Intronic
947765662 2:232635454-232635476 CCATATGCTCAGAGGGTCTTGGG + Intronic
948631905 2:239307827-239307849 CCAAATCCACAGTGGCTGTGGGG - Intronic
949063696 2:241976156-241976178 GAATAACCACAGAGAGTGTGAGG + Intergenic
1173201088 20:40955541-40955563 CTACCTCCATAGAGGGTGTGTGG + Intergenic
1175916062 20:62426580-62426602 CCATTACCACAGAGGGTGGGAGG - Intronic
1177476090 21:21625581-21625603 TAATATCCACAAAGGGTGTAAGG - Intergenic
1178951860 21:36991803-36991825 CCAAAACCAAAGAGAGTGTGAGG + Intergenic
1180809826 22:18752023-18752045 CCATGTCCAGAGAGGCTGTAGGG + Intergenic
1180827078 22:18870910-18870932 CCATGTCCAGAGAGGCTGTAGGG - Intergenic
1181195969 22:21186275-21186297 CCATGTCCAGAGAGGCTGTAGGG + Intergenic
1181213559 22:21306849-21306871 CCATGTCCAGAGAGGCTGTAGGG - Intergenic
1181524248 22:23470160-23470182 CCATGTCCAGAGAGGCTGTAGGG - Intergenic
1182131926 22:27860584-27860606 CCACATCCACAGTGGGAGTGCGG - Intronic
1183272591 22:36871460-36871482 CCACCTCCAAAGAGGTTGTGAGG + Intronic
1184015715 22:41784344-41784366 CCATTTCCACAGAGAGTGTCTGG - Exonic
1185203071 22:49520444-49520466 CCTGACCCACAGAGGCTGTGAGG - Intronic
1203230832 22_KI270731v1_random:108566-108588 CCATGTCCAGAGAGGCTGTAGGG - Intergenic
949419949 3:3855143-3855165 ACATTTCCACAGTGGCTGTGTGG - Intronic
952009069 3:28878460-28878482 TCAGACCCACAGAGGGTTTGAGG - Intergenic
952668380 3:35935603-35935625 CCATATTCTCAGAGGCAGTGAGG - Intergenic
954671772 3:52294832-52294854 CCATGTCCCCAGTGTGTGTGTGG + Intergenic
959053720 3:101549120-101549142 CCATCTCCCCAGGGGGTTTGGGG + Intergenic
961203643 3:125063609-125063631 CCAGACTCACAGAGGGAGTGAGG - Intergenic
962082016 3:132149887-132149909 TCATATCCAGAAAGGGGGTGTGG - Intronic
962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG + Exonic
967835435 3:193958655-193958677 CCATTTCCAGGGAGGTTGTGTGG + Intergenic
968621750 4:1606517-1606539 CCAGACCCCCAGAGTGTGTGAGG + Intergenic
969270947 4:6101247-6101269 CTATATACAGAGAGTGTGTGTGG + Intronic
972304251 4:37816891-37816913 CCACATCCTCAGAATGTGTGAGG - Intergenic
980385060 4:132078407-132078429 ACATAGCGACAGAGGATGTGGGG - Intergenic
980700870 4:136428518-136428540 CCATCTCCCCAGAGGGGTTGAGG - Intergenic
986145458 5:5073296-5073318 TCATATCGACAGAGGTTCTGGGG + Intergenic
987391080 5:17375928-17375950 ACATATGGACACAGGGTGTGGGG - Intergenic
991502883 5:67294691-67294713 ACATACACACAGAGGGGGTGGGG - Intergenic
993407564 5:87530400-87530422 CCATTTTCAAAGAGGGTGAGGGG + Intergenic
995362351 5:111311593-111311615 CCAAATGAACAGAGGGTGTGAGG - Intronic
996253639 5:121370188-121370210 CCACATCCCAAGAGGGTGAGAGG + Intergenic
997027079 5:130077258-130077280 CCAGAATCACTGAGGGTGTGGGG - Intronic
997740201 5:136246341-136246363 CCATATCCACACAGCATGGGAGG - Intronic
998514013 5:142736620-142736642 CCAGGTCCACACAGGGTGAGAGG - Intergenic
998596150 5:143532601-143532623 CCATATTCCCAGAGGTAGTGAGG - Intergenic
998992353 5:147831860-147831882 CCACAACCACAGAGGGAGTTAGG - Intergenic
999229433 5:150052896-150052918 CCCTCTCCACAGAGGGGATGTGG + Intronic
1001166477 5:169373834-169373856 CCATTTCTTCAGAGGGTCTGTGG - Intergenic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1011227210 6:85120421-85120443 CCATAGCCAAAGAAGATGTGTGG - Intergenic
1012384880 6:98668743-98668765 CCATTGCCACAGATAGTGTGTGG - Intergenic
1012743759 6:103055575-103055597 CTATATCCATAGTGGGTGGGTGG - Intergenic
1013589295 6:111606597-111606619 CCATAACCACTGGGGGGGTGGGG + Intergenic
1016574660 6:145555319-145555341 CCATATGCACAAAGGCTGGGAGG - Intronic
1016641706 6:146356793-146356815 CCATATACATATATGGTGTGTGG + Intronic
1017812032 6:157990403-157990425 CCCTGTCCTCAGGGGGTGTGTGG - Intronic
1018254198 6:161902222-161902244 CCATGCTCACAGAGGGTGCGAGG - Intronic
1018940962 6:168308648-168308670 CCATCTCCACAGAGGCAGGGTGG - Exonic
1021278474 7:18686095-18686117 CCATATCCAGAAAGGTTGAGAGG + Intronic
1024338950 7:48237751-48237773 GGAGATCCACAGAGGATGTGAGG - Intronic
1027953106 7:84844963-84844985 CAATAGCCACAGAGGGTTTAAGG - Intergenic
1034880223 7:154757265-154757287 CCAGTTCCTCAGAGGATGTGAGG - Intronic
1035373745 7:158394751-158394773 ACAAAAACACAGAGGGTGTGCGG + Intronic
1035935564 8:3834300-3834322 CCACATCCACAGAGGGTAAAGGG - Intronic
1037992289 8:23329647-23329669 TCAACTCCACAGAGGGAGTGAGG + Intronic
1039739774 8:40372110-40372132 TTATAGCCACAGATGGTGTGGGG - Intergenic
1039932387 8:42005615-42005637 CCAGATCCAGAGAGGGAGTGAGG + Intronic
1044949800 8:97424651-97424673 CTATATCCACAGAATTTGTGAGG + Intergenic
1047962622 8:130021883-130021905 TCGTGTCCACAGAGGCTGTGAGG - Intergenic
1049758384 8:144320829-144320851 CCATACCCACAGAGGCCATGTGG + Intronic
1056350744 9:85746234-85746256 AGATGTCCACAGAGGGGGTGAGG - Intergenic
1057959236 9:99438718-99438740 CCATATACACAGCGGTTGAGGGG - Intergenic
1059600496 9:115772233-115772255 CCATTTCCTCAGATGGTGTCTGG - Intergenic
1060019809 9:120119449-120119471 CAAGATCCACAGATGATGTGTGG - Intergenic
1061601781 9:131675067-131675089 CCCTTTCCACAGAGGGTGGTGGG + Intronic
1062004102 9:134230688-134230710 CCAGATCGACAGAGGGTGCCGGG + Intergenic
1062388483 9:136324664-136324686 CCACTTACACACAGGGTGTGTGG + Intergenic
1062555872 9:137113246-137113268 CCAAATGCACCCAGGGTGTGCGG - Exonic
1186899868 X:14042640-14042662 CCTTAGCCACAGTGGATGTGTGG + Intergenic
1187330019 X:18329252-18329274 CCATTTCCTCAGAGGATTTGGGG + Intronic
1200118034 X:153777704-153777726 CCATATGCACAGCAGGGGTGGGG - Intronic