ID: 962539820

View in Genome Browser
Species Human (GRCh38)
Location 3:136369201-136369223
Sequence CAGAGAGGGCCTTCAGCCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962539820_962539824 -2 Left 962539820 3:136369201-136369223 CCAAAGGCTGAAGGCCCTCTCTG 0: 1
1: 0
2: 0
3: 22
4: 233
Right 962539824 3:136369222-136369244 TGCCACCTGTCATTAATTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 102
962539820_962539823 -5 Left 962539820 3:136369201-136369223 CCAAAGGCTGAAGGCCCTCTCTG 0: 1
1: 0
2: 0
3: 22
4: 233
Right 962539823 3:136369219-136369241 CTCTGCCACCTGTCATTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962539820 Original CRISPR CAGAGAGGGCCTTCAGCCTT TGG (reversed) Exonic
904481844 1:30798790-30798812 CAGAGATGGCAATCAGACTTGGG + Intergenic
904623499 1:31789360-31789382 CAGAGGGGGCCCTCGGCCTTGGG - Intergenic
907443359 1:54491602-54491624 CACAGAGGGCCCTGAGCCCTGGG + Intergenic
909570669 1:77106604-77106626 CATAGAGGGCCTTTATCCATGGG - Intronic
911266936 1:95753806-95753828 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
912255673 1:108055539-108055561 CAGAATGCCCCTTCAGCCTTGGG + Intergenic
912379496 1:109239741-109239763 CAGAGAGACCCTCCTGCCTTGGG + Intergenic
919165315 1:193885062-193885084 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
919513452 1:198494201-198494223 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
920054687 1:203183521-203183543 TAAAGAGGGACTTCAGCCTCAGG - Intronic
920960767 1:210662208-210662230 CAGAGTTTGCCCTCAGCCTTCGG + Intronic
923328150 1:232898650-232898672 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
923676097 1:236081925-236081947 CAGGGAGATCCTTCAGCCTTGGG - Intergenic
1064017097 10:11781170-11781192 CAGGGAGGGCCATCTGCTTTAGG + Intergenic
1067742475 10:48906002-48906024 CAGTGGTGGCCCTCAGCCTTAGG + Intronic
1069780219 10:70950695-70950717 CAGAGAGGGCCTTCAGGGCCTGG - Intergenic
1071771134 10:88729768-88729790 CTCAGAGAGCCTTCAGCCATCGG - Intronic
1071784779 10:88886970-88886992 CAGAGAGGCTGTTCTGCCTTTGG + Intronic
1071819409 10:89264806-89264828 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1072154736 10:92714597-92714619 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1072796662 10:98361253-98361275 CAGACAGATCCTTCAGCCTCAGG + Intergenic
1074028756 10:109663731-109663753 CAGGGAGGGCCTAAAGGCTTGGG + Intergenic
1074458719 10:113617333-113617355 CAGGGAGCGCCTTCATCCTTAGG + Intronic
1074803551 10:117026235-117026257 CTGAAAAGCCCTTCAGCCTTAGG + Intronic
1076516129 10:131045342-131045364 CAGAGGGGGCTATTAGCCTTTGG + Intergenic
1078267440 11:9765740-9765762 CAGAGAGGGGCTGAAGCCTCTGG - Intergenic
1079259184 11:18861590-18861612 CAGAGAGAGCCAACAGTCTTTGG + Intergenic
1079261336 11:18884931-18884953 CAGAGAGGGCCAACAGTCTTTGG + Intergenic
1081604670 11:44520006-44520028 CAGAGAAGGCCTGCAGCCCGAGG - Intergenic
1082586536 11:54947753-54947775 CAGAGAGGACCTTCAGCTGCAGG - Intergenic
1082866125 11:57901720-57901742 TAGAAAGGGCCTTGGGCCTTTGG + Intergenic
1085154211 11:74278605-74278627 CAGAGAGAAAATTCAGCCTTGGG - Intronic
1087285292 11:96258730-96258752 CAGAGAGGCCCATCTGCCTAGGG + Intronic
1089079957 11:115767438-115767460 CAGTGTGGGCCTTCAATCTTAGG - Intergenic
1089781969 11:120879590-120879612 CGGAGAGGGTTTTCAGTCTTGGG + Intronic
1091654744 12:2337371-2337393 CAGAGAAGGCCTACAGTCTTGGG - Intronic
1094526839 12:31236871-31236893 CAGAGCGTGCCCTCAGCCCTGGG + Intergenic
1095378563 12:41560746-41560768 CAGATAGAGCTTTCAACCTTCGG - Intronic
1095603184 12:44037565-44037587 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
1096257210 12:50070737-50070759 CAGAGAGGACTTCCAGACTTGGG - Intronic
1098803012 12:74985658-74985680 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1101580895 12:106040183-106040205 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1105587386 13:21757560-21757582 AAGACAGTGCCTTCTGCCTTGGG - Intergenic
1106911211 13:34465302-34465324 CAGAGAGAGCCTTGAAACTTAGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109730165 13:66402123-66402145 CACAGATGGCTTTCTGCCTTTGG + Intronic
1111611506 13:90613782-90613804 CAGAGAATGCCCTCAGCCTAGGG - Intergenic
1115897404 14:38105488-38105510 CTCAGAGGACCTTCACCCTTGGG - Intergenic
1116130849 14:40854520-40854542 CAGAGAGGGCCTGAAGGCTGGGG + Intergenic
1120728684 14:87977392-87977414 CAGAGGGAGCCCTCACCCTTAGG + Intronic
1121274198 14:92656755-92656777 GAGAAGGGCCCTTCAGCCTTTGG + Intronic
1121368603 14:93337028-93337050 CAGAGATGGCCTAAAGCCTGGGG + Intronic
1123894189 15:24811840-24811862 CAGAGAGTGCATTCATCCCTGGG + Intergenic
1124409779 15:29427547-29427569 CAGAGACTGCCCTCAGCCCTTGG + Intronic
1127917231 15:63464795-63464817 CTGGGAGTGCCTTCTGCCTTGGG - Intergenic
1129459665 15:75694182-75694204 CAGACATGGCCTTCTGCCTGGGG - Intronic
1130272320 15:82458501-82458523 CAGACATGGCCTTCTGCCTGGGG + Intergenic
1130464671 15:84185854-84185876 CAGACATGGCCTTCTGCCTGGGG + Intergenic
1130488014 15:84408950-84408972 CAGACATGGCCTTCTGCCTGGGG - Intergenic
1130499594 15:84487683-84487705 CAGACATGGCCTTCTGCCTGGGG - Intergenic
1130586963 15:85190468-85190490 CAGACATGGCCTTCTGCCTGGGG + Intergenic
1130738187 15:86571817-86571839 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1133234511 16:4381696-4381718 CAGGCAGGGCCTGCAGGCTTAGG - Exonic
1134388881 16:13800202-13800224 CAAAGAGATTCTTCAGCCTTAGG - Intergenic
1135057090 16:19240639-19240661 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1135424821 16:22327180-22327202 AGGAGCGGGCCTGCAGCCTTGGG + Intronic
1137291530 16:47055209-47055231 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1138998228 16:62478173-62478195 CAGAGACAGCCTGAAGCCTTTGG + Intergenic
1139300156 16:65938185-65938207 CAGAGAGGTGCTTCAGGATTTGG + Intergenic
1139471671 16:67181210-67181232 CAGGGACTGCCTTCAGCCTATGG + Intronic
1139644683 16:68319790-68319812 AACAGAGGCCCTCCAGCCTTGGG - Intronic
1140217772 16:73022267-73022289 CAGCGAGAGCTTCCAGCCTTGGG - Intronic
1140956502 16:79871217-79871239 CAGTGAGGTGCTTCAGCCCTTGG - Intergenic
1142901072 17:3011968-3011990 CTGAGATGGCTTTCAGCCCTGGG - Intronic
1143157755 17:4849306-4849328 CAGAGAAAGCATTCAGCCTGAGG + Intronic
1143867484 17:9934591-9934613 CAGTGAGGGCCTTGACCCCTGGG + Intronic
1144293890 17:13855002-13855024 CACAGAGGCCCTTTATCCTTTGG - Intergenic
1144482527 17:15639616-15639638 CAGAGCTGGCCCTCACCCTTGGG + Intronic
1145282589 17:21478546-21478568 GAGAGAGGGCCATGAGCCATGGG - Intergenic
1145394889 17:22487209-22487231 GAGAGAGGGCCATGAGCCATGGG + Intergenic
1146568331 17:33932190-33932212 CAGAGAGCTCCTGCAGCCTGGGG - Intronic
1146743283 17:35305289-35305311 CCTAGAGGGCCTTCATCCTTTGG - Intergenic
1147141797 17:38464618-38464640 CAGGCAGGGCCTTGAGACTTGGG - Intronic
1147700101 17:42388344-42388366 CGGAGAGGCCCTTCGGCCTGAGG - Exonic
1148201012 17:45750063-45750085 GAGAGAGGTCCTTCAGCCTCTGG - Intergenic
1148848038 17:50540667-50540689 CACAGATGGCCTGCAGCCTCAGG - Intronic
1149160432 17:53686948-53686970 CAGAGAGGGCCTGAAGTCTGGGG - Intergenic
1150361053 17:64534434-64534456 CCCAGAAGCCCTTCAGCCTTTGG - Intronic
1151699385 17:75734890-75734912 CAGAGCAGGACTTCATCCTTTGG + Intronic
1152763372 17:82121566-82121588 GAGAGAGGCCCTTCACCTTTTGG + Intronic
1152836551 17:82536704-82536726 CAGAGGGGGCCTTTTGCCCTGGG + Intronic
1154948395 18:21184591-21184613 CAGGAAGGGCCTTCAGATTTTGG + Intergenic
1157479101 18:48041374-48041396 GAGAGAAGGCTTGCAGCCTTTGG - Intronic
1159554379 18:69929951-69929973 CAGAGATGGCATGCAGCCTGTGG - Intronic
1160285583 18:77539886-77539908 CAGAGAGGGCAGGGAGCCTTGGG - Intergenic
1160362415 18:78295186-78295208 CAGAGAGGGGATTCAGCTCTAGG + Intergenic
1160678389 19:402328-402350 CAGACAGAGCCTTCGGCCTCGGG + Intergenic
1161152987 19:2719433-2719455 CAGAGAGGTCCAGCAGCCTGAGG + Intronic
1162731625 19:12722006-12722028 CAGGGAGGGGCGTCAGACTTCGG - Intronic
1164863106 19:31578656-31578678 CAGTTAGGACCCTCAGCCTTAGG - Intergenic
1165857495 19:38888760-38888782 CACAGAGTCCCTTCAGCCATAGG + Intronic
1166948854 19:46413273-46413295 TGGAGTGGGCCTTGAGCCTTGGG - Exonic
1167146118 19:47681434-47681456 CAGCCAGGGCCCTCACCCTTCGG - Intronic
1168306657 19:55439550-55439572 CAGAGAGGGCCTTGAGCGCCAGG - Intronic
925375208 2:3379287-3379309 CTAAGAGGGCCTTCATACTTCGG + Intergenic
925741140 2:7006963-7006985 CAGAGTGGCCCTTCATCCCTTGG - Intronic
926423334 2:12718847-12718869 CAGAGAGCTCCTGGAGCCTTCGG - Intronic
927147314 2:20174704-20174726 CACAGAGGGCCTTGAGACTTGGG + Intergenic
927351845 2:22125205-22125227 CAGAGAGCCCCTTCAGCCCAAGG - Intergenic
927743197 2:25590804-25590826 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
928181287 2:29070792-29070814 CCGAGAGGGCCCCCAGCCTCTGG + Exonic
929824326 2:45298569-45298591 CAGTGAGGCCCTTCAGTCTGGGG + Intergenic
929987996 2:46756481-46756503 CAGATTTGGCCTTCAGGCTTTGG + Intronic
930612004 2:53554211-53554233 CGGAGAGGGCCTGAAGCCTGGGG + Intronic
930839184 2:55826316-55826338 CAGGGAGGGCCTCCAGGCTTGGG + Intergenic
931300473 2:60973724-60973746 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
931784833 2:65609254-65609276 CAGAGAGGCCCTTCACACTCAGG - Intergenic
933074553 2:77907013-77907035 CAGTTAGGACTTTCAGCCTTCGG - Intergenic
934069590 2:88371792-88371814 CAAAGTCAGCCTTCAGCCTTAGG - Intergenic
937621874 2:123997798-123997820 CTGAGAGGGCCTCCAGAGTTAGG + Intergenic
937868421 2:126770884-126770906 CAGAAAGGGGCTGCTGCCTTGGG + Intergenic
937871200 2:126787610-126787632 CAGAGAGAGCCAGCAGCATTAGG + Intergenic
938069336 2:128300265-128300287 CGGAGAGGGCCTGCAGCCCCAGG + Intronic
938730599 2:134144029-134144051 AAGAGCAGGCCATCAGCCTTGGG + Intronic
939905633 2:147910348-147910370 CTGAGAGATCCTTGAGCCTTTGG + Intronic
940046829 2:149418669-149418691 CAGAGAAGGCCTAGAGCATTTGG + Intronic
941131051 2:161650958-161650980 CAGAGATGGCCTGAAGCCTGGGG + Intronic
941602776 2:167562989-167563011 GAGAGAGGTTCTTCTGCCTTGGG - Intergenic
941816337 2:169799324-169799346 CAGAGATGGCCACAAGCCTTCGG - Exonic
943367610 2:186980968-186980990 CAGAGAGGGCGTTAAGCCCAGGG - Intergenic
943950490 2:194128737-194128759 CAGAGAAGGCCTGAAGCATTGGG - Intergenic
947523793 2:230866416-230866438 CGGAGAGGGCCGTCAGAGTTGGG + Intronic
948823387 2:240561426-240561448 CAGGGAGAGCCCCCAGCCTTAGG + Exonic
1170941301 20:20850141-20850163 CAGACAGGGCCTTTAGACTACGG - Intergenic
1171411541 20:24951452-24951474 CAGCAAGGGCCTTCAGTCTTCGG + Intronic
1171958748 20:31478242-31478264 AAGAAAGGGGGTTCAGCCTTAGG - Intronic
1172119502 20:32589491-32589513 CAGAGAGGCCCCAGAGCCTTGGG + Intronic
1172737498 20:37138673-37138695 CAGAGATGTCCATCAGGCTTAGG + Intronic
1172971915 20:38879923-38879945 CAGAGAGAATCTTCACCCTTTGG - Intronic
1177037427 21:16060952-16060974 CAGAGATGGCCTGAAGCCTGGGG - Intergenic
1177489684 21:21806046-21806068 CAGAGAGGGACTTAAGAATTTGG - Intergenic
1177809947 21:25915082-25915104 CACAGAGGGCCTTCAGCATCTGG - Intronic
1178686715 21:34717362-34717384 CACTGAGGGACTGCAGCCTTGGG - Exonic
1179151051 21:38808420-38808442 CAGAGAGGGGCAGCAGTCTTGGG - Intronic
1179908996 21:44438181-44438203 CAGAGGGGGCCTTTGGCCTTGGG + Intronic
1179940593 21:44637039-44637061 CAGCGTGGGCCCTCAGCCTGGGG - Intronic
1179999722 21:44990046-44990068 CGGAGACGGCTTTCGGCCTTGGG - Intergenic
1181360425 22:22330016-22330038 CACAGAGGGGCTTCAGCCTGGGG + Intergenic
1181411109 22:22720441-22720463 CAGAGAAGGCCATCAGGCTCAGG + Intergenic
1181734378 22:24870251-24870273 CATGGAGCCCCTTCAGCCTTGGG - Intronic
1181988374 22:26817819-26817841 CAGAGAGGGTCTTAAGCAATTGG - Intergenic
1182599016 22:31445183-31445205 TAGGGAGGGCCTTCATTCTTGGG + Intronic
1182707919 22:32299872-32299894 CAGAGAGGACCCTCAGCTGTAGG + Intergenic
1184189666 22:42886271-42886293 AAGAGGCGGCCTTCACCCTTAGG + Intronic
1184262998 22:43329970-43329992 CAGAGAGGGGCTGCTGCCTGGGG + Intronic
1184917113 22:47577356-47577378 CAGAGATGGCGGTCAGCTTTTGG + Intergenic
1184943801 22:47786986-47787008 CAGAGCCCTCCTTCAGCCTTGGG + Intergenic
949842724 3:8337700-8337722 CAGAGAGGTCTTTCAGCCTAGGG + Intergenic
950450581 3:13062943-13062965 CTGACAGGACCTTCATCCTTCGG + Intronic
951243899 3:20317760-20317782 CAGAGATAGCCTTCAACCTACGG - Intergenic
953024417 3:39136672-39136694 CAGGGAGAGCCTGCAGCCTCTGG + Intronic
953418006 3:42734052-42734074 CAGTGAGGGCAGGCAGCCTTGGG + Intronic
953796210 3:45987969-45987991 CAGAGAAGGTCTCCTGCCTTGGG - Intronic
954993659 3:54862600-54862622 CAGAGAGAGCCTTCAACTTCAGG - Intronic
955493378 3:59505647-59505669 CAGAGAGGGCCATCAGGCATTGG - Intergenic
956989992 3:74751831-74751853 CAGAGAGGGCCTGAAGACTGGGG - Intergenic
960897086 3:122516231-122516253 CAGAGCCGGTCTTCAGTCTTTGG + Intergenic
961565941 3:127763442-127763464 CAGAGCTGGCCTTGAGCCTGAGG - Intronic
962539820 3:136369201-136369223 CAGAGAGGGCCTTCAGCCTTTGG - Exonic
962928639 3:140017640-140017662 CAGCGGGGCCCATCAGCCTTTGG + Intronic
963059600 3:141214517-141214539 TAGGGAGGGACTTCAGCCATGGG - Intergenic
964245960 3:154653930-154653952 CAGAGAAGGCCATCTGCCTTAGG + Intergenic
965517826 3:169640957-169640979 CACAGAGGGCATGAAGCCTTTGG + Intronic
965774001 3:172209683-172209705 CAGGGAGGGCCTGAAGCCTATGG - Intronic
966852801 3:184175069-184175091 CCGGGAGTGGCTTCAGCCTTCGG + Intronic
969278236 4:6151414-6151436 CAGAGAGGGCGCTGAGCATTTGG - Intronic
975710844 4:77158186-77158208 CAGGGAGGGCCTTCTGCCCAGGG - Intronic
978561866 4:110042345-110042367 CAGAAAGGGCATTCATCCATGGG + Intergenic
980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG + Intergenic
988425924 5:31064262-31064284 CCTAGAAGGCCTTCAGCCTTGGG + Intergenic
989516888 5:42354059-42354081 CAGTCAGGGCCTTCAGCTTCAGG - Intergenic
990537937 5:56742152-56742174 AAGAGACAACCTTCAGCCTTCGG - Intergenic
990616465 5:57513332-57513354 AAGAGAGGCCCTTCAGCTTGTGG - Intergenic
992029681 5:72709023-72709045 CAGGGATGACCTGCAGCCTTGGG - Intergenic
995482639 5:112608271-112608293 CAGAGAGGCCCTTCAGCTCAAGG - Intergenic
996217551 5:120887702-120887724 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
996923863 5:128800115-128800137 CAGAGAGGGCCTGAAGGCTGGGG - Intronic
997370622 5:133357361-133357383 GAGAGAGGAGCTTCTGCCTTGGG - Intronic
1001269790 5:170302624-170302646 CAGCAAGGGACTTCAGCCTCTGG - Intergenic
1001303824 5:170556934-170556956 CAGTGTGGGCGTTCTGCCTTAGG + Intronic
1002004084 5:176217472-176217494 CAGAGAGCCCCTTCAGCTTAAGG - Intergenic
1002222290 5:177693168-177693190 CAGAGAGCCCCTTCAGCTTAAGG + Intergenic
1003512148 6:6790545-6790567 CAGAAAGAGCCTCCACCCTTGGG + Intergenic
1006643138 6:35498518-35498540 CAGACAGTGCCCTCAACCTTGGG + Intronic
1006719726 6:36142470-36142492 CACAGAGGGCCTGCAGCCCAGGG - Intronic
1007012031 6:38427032-38427054 CAGAGAGGTCCTACAGGCCTAGG - Intronic
1008706370 6:54165419-54165441 CAAAGTGGTCCTTCAGCCTTTGG - Intronic
1012523259 6:100146101-100146123 CATATAGGGCTTTCAGCCATAGG - Intergenic
1015494385 6:133865379-133865401 CAGACAGGGCCTTTAGTCCTGGG - Intergenic
1016679079 6:146807479-146807501 CAGAGAGAGCTTCCAGCTTTAGG - Intronic
1017719098 6:157232558-157232580 CAGAGAGGTCCCTCAACCATTGG + Intergenic
1020070979 7:5226943-5226965 CAGGGAGGAGCTACAGCCTTTGG - Intronic
1020073736 7:5243920-5243942 CAGAGAGGGCTTTGGGGCTTCGG + Intergenic
1021021138 7:15599956-15599978 CAGTGAGGGCCTGAAGCCTGGGG - Intergenic
1022545113 7:31180013-31180035 CCCAGAGGGCCTTCAGGATTAGG + Intergenic
1023790455 7:43749725-43749747 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1024704188 7:51939084-51939106 CTGAGCTGCCCTTCAGCCTTCGG - Intergenic
1026015191 7:66666635-66666657 CAGCCAGGACCTGCAGCCTTGGG - Intronic
1026891587 7:73985772-73985794 CAGCCAGGACCTGCAGCCTTGGG - Intergenic
1027734945 7:81920527-81920549 CAGAGACGGCCTAAAGCCTGGGG - Intergenic
1028035143 7:85972516-85972538 CAGAGACAGCCTTAAGCCTGGGG - Intergenic
1030069344 7:105685594-105685616 CAGAGGGGCCCCTCAGCCTGTGG + Intronic
1031520879 7:122764200-122764222 GTAAGAGGGTCTTCAGCCTTAGG - Intronic
1031786572 7:126040876-126040898 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1034566227 7:151917736-151917758 CATAATGGGCCTTCAGCCCTGGG - Intergenic
1035693876 8:1578870-1578892 CAGACGGGGCCATCAGCCCTGGG - Intronic
1036751134 8:11444309-11444331 CGGTGAGGGCCTTCAGGCTCCGG + Exonic
1037711272 8:21357315-21357337 CACAGAGGGCCCTCAGGCCTGGG + Intergenic
1038556700 8:28524740-28524762 CAGAGAGAGGCTACAGACTTAGG - Intronic
1039182327 8:34880531-34880553 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1041520960 8:58755902-58755924 CTGAGAGCACGTTCAGCCTTGGG - Intergenic
1042396050 8:68292864-68292886 CAGGGAGGGCCTGCAGGCTGCGG + Intergenic
1042699511 8:71596886-71596908 CAGAGAAGGACTTCAGCTTCAGG + Intergenic
1043181326 8:77089198-77089220 CAGAGAGGACCCTCAGCTGTAGG - Intergenic
1044053763 8:87542690-87542712 CAGGGAGGGCCTGCAGCCTGGGG - Intronic
1049225639 8:141449306-141449328 CAGAGAGGGGCTTCAGGTATAGG - Intergenic
1049404366 8:142445139-142445161 CACAGAGGCCCTTCAGCCTGTGG + Intergenic
1049443650 8:142620251-142620273 CAGAGAGGGCGTGGAGGCTTAGG - Intergenic
1050926719 9:11273126-11273148 CAGAAAAGACCTTCTGCCTTGGG + Intergenic
1053434053 9:38063549-38063571 CAAAGAGGGCCTTCAGCAGAAGG - Intronic
1053860485 9:42381818-42381840 CAGTAAGGTACTTCAGCCTTGGG - Intergenic
1055873140 9:80909312-80909334 CATAAAGGGCCTTCAGCCACAGG + Intergenic
1056524814 9:87433154-87433176 CAGGGAGGGACTTCAGTCTTGGG - Intergenic
1057428578 9:94974513-94974535 CGGAGAGGGCCTTTTGCCTCTGG + Intronic
1057440371 9:95078677-95078699 CTGCAAGGCCCTTCAGCCTTGGG + Intronic
1057607006 9:96505975-96505997 CTGAGAGGCTCTTCAGCTTTGGG - Intronic
1058024228 9:100123221-100123243 CAGAGAAACCCTTCACCCTTTGG + Intronic
1060180112 9:121527896-121527918 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1060207044 9:121688273-121688295 CACAGAGGGCCTCCTGGCTTTGG - Intronic
1060222917 9:121773899-121773921 CAGACACTGCCTGCAGCCTTTGG - Intronic
1060556960 9:124512932-124512954 CAGAGCTGGGCTCCAGCCTTGGG + Intergenic
1061297126 9:129682746-129682768 CAGAGAGGGGCTCCATCCTCAGG + Intronic
1061868808 9:133509243-133509265 CAGAGAGTGCTTGCAGCCCTGGG - Intergenic
1062295422 9:135822755-135822777 CAGCGAGGGCCCCCAGCCTTTGG - Exonic
1062637107 9:137497321-137497343 CACAGAGGCCCTGCAGCCCTGGG + Intronic
1188959216 X:36470407-36470429 CAGAGAGGGCCCTCAGCTGCAGG + Intergenic
1189010609 X:37042997-37043019 CAGACAGGCCCCTCAGCCATGGG - Intergenic
1190876191 X:54461947-54461969 CAGTGAGAGCCTTCAGCTTGAGG - Intronic
1190909568 X:54758675-54758697 CATAGAGGCCCTTCAGCTGTAGG + Exonic
1194316136 X:92379616-92379638 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1195684403 X:107572475-107572497 TAGAAAGAGCCTTCAGACTTTGG + Intronic
1197035642 X:121870423-121870445 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1200624181 Y:5491190-5491212 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1201404956 Y:13640643-13640665 CAGAAAGGGCCTTAAGACATAGG + Intergenic
1201640186 Y:16169735-16169757 CCCAGAGGGCCTTCATCCTCTGG + Intergenic
1201662628 Y:16415590-16415612 CCCAGAGGGCCTTCATCCTCTGG - Intergenic