ID: 962548491

View in Genome Browser
Species Human (GRCh38)
Location 3:136463217-136463239
Sequence CAGCTACTTACTGGGCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962548491 Original CRISPR CAGCTACTTACTGGGCATGC TGG (reversed) Intronic
902716216 1:18274736-18274758 CACCTAATGACTGGGCATGGTGG + Intronic
903172914 1:21564600-21564622 CAGCTCTTTGCCGGGCATGCTGG - Intronic
907019184 1:51048858-51048880 CAGGCAGTTGCTGGGCATGCTGG - Intergenic
907491078 1:54809219-54809241 CAGCTGCTAAGTGGGCAAGCTGG + Intronic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
914195420 1:145445860-145445882 CAGGTACTTGCTGGGCACGATGG - Intergenic
915317095 1:155034784-155034806 CGACTCCTTCCTGGGCATGCAGG - Intronic
915670482 1:157485167-157485189 GACCTACTAACCGGGCATGCTGG + Intergenic
916474151 1:165152681-165152703 CAGTTATTTACAGGGCATGGTGG - Intergenic
917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG + Intronic
921194996 1:212747225-212747247 CTGTTAGTTACTGGTCATGCAGG - Intronic
923025836 1:230203279-230203301 GGGGTACTTACTGGTCATGCCGG - Exonic
1063751695 10:8956179-8956201 TAGCCACTTTCTGAGCATGCTGG - Intergenic
1068093879 10:52466407-52466429 CAGCTACTTACAGCCTATGCTGG + Intergenic
1071063430 10:81601561-81601583 CAGCTAGTTATAGGACATGCTGG + Intergenic
1071955361 10:90751618-90751640 CACCTACTTACTGGGAAGGGGGG + Intronic
1072238685 10:93475145-93475167 TAACTTCTTACTGGGCATGAGGG - Intronic
1075918130 10:126187464-126187486 CAGCCACTTGCTGGGCACCCCGG - Intronic
1078934420 11:15939101-15939123 CAGCTAGTGAATGGGCATGTTGG + Intergenic
1079123584 11:17702495-17702517 CAGCTACTGGCTGGGCATGGTGG - Intergenic
1080314009 11:30927553-30927575 CAGCTAGTTAGTGGCAATGCTGG + Intronic
1080830362 11:35888292-35888314 CAGCCACTGGCTGGGCATGGTGG + Intergenic
1080873122 11:36254117-36254139 CAGCTACTTACTGGCTGTGGGGG + Intergenic
1081470188 11:43362744-43362766 CAACAACTTGCTGGGCATGGTGG - Intronic
1086108143 11:83169209-83169231 CAGCTACTGACTGACCATGGGGG - Exonic
1086860750 11:91922233-91922255 CAGCTAGGTGCAGGGCATGCAGG + Intergenic
1088082053 11:105930099-105930121 CAGAGACCTACTGGGCTTGCTGG + Intronic
1090399420 11:126439527-126439549 CAGATACTGGCTGGGCATGGTGG + Intronic
1091130721 11:133144956-133144978 CAGCTACTTTGTGGGCATCTAGG + Intronic
1092245455 12:6861591-6861613 CAGCTACTGACTTGGCCTGCAGG - Exonic
1096031526 12:48420212-48420234 CAGCTGCCTCCTGGGCTTGCAGG - Intergenic
1097665120 12:62469228-62469250 CAGCTTCTGGCTGGGCATGGTGG - Intronic
1098547495 12:71727621-71727643 CATCTTCATACTGGGCATGGTGG - Intergenic
1100084357 12:90890729-90890751 CAGCCAGTCACTGGGCATGCTGG + Intergenic
1101122628 12:101598724-101598746 CAGCTATTAGCTGGGCATGATGG - Intronic
1101153624 12:101907089-101907111 CAGCTACTTGCTGGGCTGGGAGG + Intronic
1101566544 12:105911136-105911158 CAACTACTTTCTAGGCCTGCTGG - Intergenic
1101810278 12:108101977-108101999 CAGGGACTTACTGGGCAGTCTGG + Intergenic
1102004187 12:109578476-109578498 CACCTACTTCCAGGGAATGCTGG - Intronic
1104874142 12:132021310-132021332 AGGCCACTTACTGGGCAAGCGGG - Exonic
1105803305 13:23930376-23930398 CAGCTACTTCCTGCGTATTCAGG - Intergenic
1107287067 13:38805480-38805502 GAGCTACCTGCAGGGCATGCAGG + Intronic
1111493762 13:89021031-89021053 CAGCTACTATCTGGTCATACTGG - Intergenic
1113067119 13:106383836-106383858 CAGCTGGTTACTGGGTAGGCAGG - Intergenic
1117061533 14:51968450-51968472 TAGCTCCTTCATGGGCATGCTGG + Exonic
1120179712 14:81330808-81330830 CAGCTAATCCTTGGGCATGCAGG - Intronic
1120754824 14:88233005-88233027 CAGCTAGTGACTGAGCCTGCTGG - Intronic
1121274569 14:92658769-92658791 CAGTCATTTACTGGGCATTCAGG + Intronic
1123152254 14:106193614-106193636 AGGCTTCTTCCTGGGCATGCAGG + Intergenic
1123172365 14:106386018-106386040 AGGCTTCTTCCTGGGCATGCAGG + Intergenic
1123400644 15:19981561-19981583 AGGCTTCTTCCTGGGCATGCAGG + Intergenic
1125875785 15:43142955-43142977 CTTCTACTGACTGGGCATGGTGG - Intronic
1128680655 15:69649027-69649049 CAGCTGCTTACAGGGTAGGCAGG + Intergenic
1128723482 15:69970569-69970591 CAGGCACTGGCTGGGCATGCTGG + Intergenic
1130141948 15:81235076-81235098 TAGCTGTTTACTGGGCATGGGGG - Intronic
1131086621 15:89580916-89580938 CAGCTACTTACTCAGGAGGCTGG + Intronic
1132727054 16:1343441-1343463 CAGCTACCTGCTGGGGCTGCTGG + Exonic
1132803447 16:1765167-1765189 CAGCTGCTCACCGGGGATGCTGG - Exonic
1139674229 16:68511844-68511866 CAGCTACTCACCTGGCAGGCAGG + Intergenic
1141964044 16:87429501-87429523 CAGCAACTTGTTGGGCATGGCGG + Intronic
1146532080 17:33616603-33616625 CAGTTAATAACTGGACATGCTGG + Intronic
1146808824 17:35887431-35887453 CAGCTACTCAGTGGGGAGGCAGG + Intergenic
1149399397 17:56279513-56279535 CAGCTATTGACTTGGCATCCAGG + Intronic
1151295418 17:73182377-73182399 CAGGTACTGGCTGGGCATGGTGG - Intergenic
1156268438 18:35509100-35509122 CAGCTACATAGTGGTCCTGCTGG + Intergenic
1159881758 18:73864919-73864941 CAGCTCCTTACAGGGCACGAAGG + Intergenic
1160138956 18:76302135-76302157 AAACTACTTTCTGTGCATGCTGG + Intergenic
1160372820 18:78389115-78389137 CAGCCACGTTCTGTGCATGCCGG + Intergenic
1161396185 19:4045987-4046009 CAGCTCCTTGGTGGCCATGCGGG + Exonic
1165718035 19:38059286-38059308 CAGCTGTTTGCTGGGCATGGTGG - Intronic
1165720432 19:38075167-38075189 CAACTATTTACTGGGCGTGGTGG + Intronic
1167439517 19:49500252-49500274 CAGCTACTCACTGGGACTTCAGG - Intergenic
1167979867 19:53266036-53266058 CAGATGCTGACTGGGCGTGCTGG - Intergenic
926218748 2:10921449-10921471 CAGCTAGGTACAGGGCATGGAGG - Intergenic
927520087 2:23693285-23693307 CAGCAACTGCCTGGGCGTGCTGG + Exonic
928126568 2:28620632-28620654 CTGCTACTTACTGGGCAGTGTGG - Exonic
928587673 2:32777596-32777618 AAACTCCTTACTGGGCATGTTGG - Intronic
930719220 2:54622863-54622885 CAGATACTTACTGGGCTTATGGG - Intronic
930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG + Intergenic
932756511 2:74413606-74413628 CAGAAACTTCCTGGGCCTGCTGG + Intergenic
933111611 2:78408360-78408382 CAGCTGCTTAGTGGGCTTGGGGG + Intergenic
938608289 2:132919871-132919893 CAGATACTTACTGCTCATTCTGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941662506 2:168209560-168209582 CAGCTACTTACTCGGTTGGCTGG + Intronic
942279365 2:174344355-174344377 CTGCTACATTCTGGGCATTCTGG + Intergenic
942642901 2:178078245-178078267 CAGCTTTTTACTGGGGAAGCAGG - Intronic
945668675 2:212774767-212774789 CAGCTACTTAAGTGGCATCCTGG + Intergenic
947765261 2:232633700-232633722 CAGCTCCTCACTGGCCATGGCGG - Exonic
948937400 2:241176198-241176220 CAGGCACTGACTGGGCATGGTGG - Intronic
1170538002 20:17360742-17360764 CAGCAAGATACTGGGCATGATGG + Intronic
1171367788 20:24637980-24638002 CAGCTAGTTAATGGCCAAGCTGG + Intronic
1174106543 20:48166229-48166251 CAGCTACTTACTGGCAGAGCTGG - Intergenic
1175310809 20:58010595-58010617 CATCTACAAACTGGGGATGCTGG + Intergenic
1177358354 21:20037670-20037692 AAACTACTTCCTGGGTATGCAGG - Intergenic
1180149646 21:45941025-45941047 CACCCACTCACTGGGCGTGCAGG - Intronic
1180733611 22:18000501-18000523 CGGCTACCTACTGAGCAAGCGGG + Intronic
1181138483 22:20786340-20786362 CAGACACTTACTGGGCAGGGGGG + Intronic
1182654193 22:31876863-31876885 CAGCATCTTGCCGGGCATGCTGG + Intronic
1184449893 22:44576604-44576626 CAGCTCCTCACTGGCCTTGCAGG + Intergenic
950730277 3:14950239-14950261 CAGCTAGTTACATGGCATCCAGG + Intronic
951845367 3:27079128-27079150 CAGCAACTTTCTAGGCATCCAGG - Intergenic
952983942 3:38760859-38760881 CATGTACTCAGTGGGCATGCTGG + Intronic
953691533 3:45124060-45124082 CAGCTCCTTCCTGGGCAGGCAGG + Intronic
956757407 3:72402527-72402549 CAGCTAGTTACTATGCATGAGGG - Intronic
961724397 3:128916696-128916718 CATTTCCTTACTGGGCCTGCTGG - Intronic
962043999 3:131736332-131736354 AAGCTACTGTCTGGGCATGGTGG + Intronic
962548491 3:136463217-136463239 CAGCTACTTACTGGGCATGCTGG - Intronic
963172992 3:142270254-142270276 CAGCTGCTTAATGGGCATGAGGG - Intergenic
963814954 3:149819030-149819052 CAGCTAATTAGTGGGAATGTTGG - Intronic
965711600 3:171561327-171561349 CAGCTACTTAGTGACCAAGCTGG + Intergenic
966628904 3:182050297-182050319 CAGCTACTCACTGAGTTTGCAGG - Intergenic
969912241 4:10457306-10457328 CAGCTACTTACCCGGCAGGCCGG + Exonic
975155037 4:71061911-71061933 CAGCTATTGGCTGGGCATGGTGG + Intergenic
975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG + Intergenic
976435651 4:85014700-85014722 CAGCTAATGACTGAGCATGGTGG + Intergenic
977029673 4:91865647-91865669 CAGCTACTGACTGAGCATGGTGG + Intergenic
980521825 4:133946117-133946139 CAGCTACATGTTGGGTATGCAGG - Intergenic
985587431 5:748161-748183 CAGCTTCTTGCTGGGCCTGCTGG + Intronic
985601985 5:840252-840274 CAGCTTCTTGCTGGGCCTGCTGG + Intronic
986574526 5:9198385-9198407 CAGCTACTAAATGGGGAAGCTGG + Intronic
989634125 5:43516311-43516333 AAGCAACTTCCTGGGCATGCCGG + Intergenic
992787126 5:80181094-80181116 CAGCTATCTACTGGGCAGGGGGG + Intronic
996192694 5:120564697-120564719 CAGGTACTGGCTGGGCATGGTGG + Intronic
997425246 5:133798785-133798807 CAGCTACTTGGTAGGCATGGGGG - Intergenic
999421823 5:151451046-151451068 CCTCTACTTAATGGGCATGGGGG + Intronic
1002589653 5:180281341-180281363 AAGCTGCTTTCTGGGCCTGCTGG - Intronic
1003332173 6:5138329-5138351 CAGAAACTAACTGGGCATGGTGG + Intronic
1006500472 6:34455741-34455763 AAGTGACTTACTGGGCATGGTGG - Intergenic
1007556207 6:42768669-42768691 CAGATTCTCACTGGGCATGGAGG - Intronic
1007859705 6:44895345-44895367 CAGCTTCTTACTGGGATTACAGG + Intronic
1015062104 6:128978601-128978623 CAGGTACTGACCGGGCATGGTGG - Intronic
1015134198 6:129849493-129849515 CAGATAGTTACTGGGCAGGGTGG + Intronic
1015862720 6:137697509-137697531 CAGCCACTCTCTGGGCAGGCTGG - Intergenic
1016624428 6:146149608-146149630 CAGCTCTTTACTGAGGATGCAGG + Intronic
1017205617 6:151801843-151801865 CAGCAAAGTGCTGGGCATGCAGG - Intronic
1017237881 6:152136295-152136317 CAGATATTTACTGGGCAAGTAGG - Intronic
1018674194 6:166205120-166205142 CAGCCACTTTCTGGGCCTGGTGG - Intergenic
1018923201 6:168189848-168189870 CAGCTACTTGCTGGGAAGGTGGG + Intergenic
1023057964 7:36304805-36304827 CAGCTGCTAAGTGGGCAGGCTGG - Intergenic
1026113730 7:67478705-67478727 AACCTACTGACTAGGCATGCTGG - Intergenic
1026166293 7:67912667-67912689 CAGCTATCACCTGGGCATGCTGG + Intergenic
1029273244 7:99389601-99389623 CAACTACTAACTGGCCATGGTGG - Intronic
1033871091 7:145753210-145753232 CAGCTTGTTGCTGGGCGTGCCGG - Intergenic
1034886867 7:154804914-154804936 CAGCTACTTCCTGAGCACGGAGG + Exonic
1036196102 8:6716406-6716428 CAAACACTTACTGGGCATGGTGG + Intronic
1036382869 8:8249892-8249914 CAGCTGCTGGCTGGGCATGGTGG + Intergenic
1038065868 8:23963261-23963283 CAGCTACCACCTGGGCTTGCTGG + Intergenic
1044787476 8:95809837-95809859 CAGCTACTATCTGAGCATGGTGG + Intergenic
1047422925 8:124722012-124722034 CAGCAGCTTCCTGGGCATGGAGG - Intronic
1055371159 9:75601207-75601229 CAGCCAGTGACTGAGCATGCTGG + Intergenic
1056359717 9:85843296-85843318 CAGGTGCGTACTGGGCATGGTGG - Intergenic
1056785268 9:89588070-89588092 CAGCTTCTAGCTGGGCATGATGG - Intergenic
1057264579 9:93606089-93606111 CAGCTACTTACTTAGGAGGCTGG - Intronic
1057568451 9:96185247-96185269 CAGGTATTTTCTGGGAATGCTGG - Intergenic
1059337627 9:113579188-113579210 CAGCTACTCACTGAGCAGCCAGG - Intronic
1061761817 9:132856755-132856777 CAGCCACTTCGTGGGCATGACGG + Intronic
1062699245 9:137890490-137890512 CAGGTACTTGCTGGGCACGATGG + Intronic
1189198446 X:39171133-39171155 CAAATACTAACTGGGCATGGTGG + Intergenic
1189787156 X:44569360-44569382 CAGATACTTCCTGGGCCTGTAGG - Intergenic
1193564131 X:83056426-83056448 CAGGTACTTCCTGGACATGCAGG + Intergenic
1195321908 X:103727611-103727633 CAGTCACTTCCTGGGCTTGCAGG - Intronic
1195664072 X:107412811-107412833 GAGCTACTTCCTGGGCCTCCAGG + Intergenic
1196209756 X:112982575-112982597 CAGCTACTCAGGGGGCAGGCAGG - Intergenic