ID: 962556689

View in Genome Browser
Species Human (GRCh38)
Location 3:136559763-136559785
Sequence AAACTCAGCCTCTCAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962556689_962556692 12 Left 962556689 3:136559763-136559785 CCTATCTTTGAGAGGCTGAGTTT 0: 1
1: 0
2: 1
3: 19
4: 342
Right 962556692 3:136559798-136559820 TCAAAAAACCAATATAAAACAGG 0: 1
1: 0
2: 3
3: 66
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962556689 Original CRISPR AAACTCAGCCTCTCAAAGAT AGG (reversed) Intronic