ID: 962556689 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:136559763-136559785 |
| Sequence | AAACTCAGCCTCTCAAAGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 363 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 342} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962556689_962556692 | 12 | Left | 962556689 | 3:136559763-136559785 | CCTATCTTTGAGAGGCTGAGTTT | 0: 1 1: 0 2: 1 3: 19 4: 342 |
||
| Right | 962556692 | 3:136559798-136559820 | TCAAAAAACCAATATAAAACAGG | 0: 1 1: 0 2: 3 3: 66 4: 960 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962556689 | Original CRISPR | AAACTCAGCCTCTCAAAGAT AGG (reversed) | Intronic | ||