ID: 962558328

View in Genome Browser
Species Human (GRCh38)
Location 3:136578956-136578978
Sequence TTCTAGTTTATTATCTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962558328_962558330 -4 Left 962558328 3:136578956-136578978 CCTACCAAGATAATAAACTAGAA 0: 1
1: 0
2: 3
3: 26
4: 335
Right 962558330 3:136578975-136578997 AGAAGTAAACACTACATCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 180
962558328_962558331 -3 Left 962558328 3:136578956-136578978 CCTACCAAGATAATAAACTAGAA 0: 1
1: 0
2: 3
3: 26
4: 335
Right 962558331 3:136578976-136578998 GAAGTAAACACTACATCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962558328 Original CRISPR TTCTAGTTTATTATCTTGGT AGG (reversed) Intronic
901531301 1:9854481-9854503 TTCTTGTTCATAATCTTGGTAGG - Intronic
901941997 1:12669516-12669538 TTCTGACTTATTATCTTGGTAGG - Intergenic
901942578 1:12674898-12674920 TTCTGGCTTATTGTCTTGGTAGG + Intergenic
904279106 1:29405953-29405975 TTCAAGTTTACTATCTTTCTAGG - Intergenic
905367735 1:37463589-37463611 TTCTAGATTTTTTTTTTGGTCGG - Intergenic
906074736 1:43043645-43043667 TTTTGATTTAATATCTTGGTGGG - Intergenic
906189525 1:43887387-43887409 TTCTAGTCTATTATCTCTCTTGG - Intronic
907063466 1:51455194-51455216 TTAAAGTTTATTCTCTTTGTGGG - Intronic
910515184 1:88052977-88052999 TTCTAGTTTCCCATCTTGGTAGG + Intergenic
910830664 1:91458055-91458077 TGCTACTTTATTATCTTTCTTGG + Intergenic
910891178 1:92021843-92021865 TTCTTCTTAATTATCTTGTTTGG - Intergenic
911155430 1:94631753-94631775 TTCTAGTATATTCTCCTAGTGGG + Intergenic
911787783 1:101972431-101972453 TTCCAGTTGATTATCTTGTCTGG + Intronic
911992165 1:104712853-104712875 TTCTAGTTTCTAATTTGGGTCGG + Intergenic
916772888 1:167930449-167930471 ATCTAGTTTTTTATCCTTGTTGG - Intronic
917693501 1:177493409-177493431 TTCTAGTTTGTTATTATGATTGG - Intergenic
919260964 1:195192847-195192869 TTTTATTTTTTTATCTTTGTTGG - Intergenic
919875519 1:201863676-201863698 TTCCAGTGTATTATGTTGCTTGG + Intronic
920187553 1:204170417-204170439 TTCTAGGTTTTTGTCCTGGTGGG + Intergenic
921239030 1:213157520-213157542 TTCTAGTTAATTGTTATGGTTGG + Intronic
921447737 1:215266282-215266304 TTTTGGTTTACTATCCTGGTAGG + Intergenic
921464144 1:215465105-215465127 TTCTAGTTATTCATCATGGTGGG - Intergenic
922637852 1:227193905-227193927 TTATGGATTATTATGTTGGTGGG - Exonic
923073061 1:230583420-230583442 TTCTATTTTACTATTTTGGTAGG + Intergenic
923536995 1:234860461-234860483 TTCTAGTTTATTCCATTGTTTGG - Intergenic
1065953095 10:30669360-30669382 TTCTAGTTCATCATCTTGTGGGG - Intergenic
1066496436 10:35946983-35947005 TTCAAGTTCATTTTTTTGGTTGG - Intergenic
1066749491 10:38638291-38638313 TTATATTTTATTATTTTGGGAGG - Intergenic
1066967155 10:42279501-42279523 TTATATTTTATTATTTTGGGAGG + Intergenic
1067878237 10:50022797-50022819 TTGGACTTTATTATCTTTGTGGG - Intergenic
1067893480 10:50155105-50155127 TTGGACTTTATTATCTTTGTGGG + Intergenic
1068481174 10:57590475-57590497 TTCTATTTTTTTTTCTTGGTGGG + Intergenic
1068732216 10:60372136-60372158 TTTTAGTTTTATCTCTTGGTTGG - Intronic
1069206633 10:65697225-65697247 TTCTATTTTATTTTGTTTGTTGG - Intergenic
1072375106 10:94806749-94806771 TTATAATTTATTATTTTAGTGGG + Intronic
1072429866 10:95361306-95361328 TGCTAGTTTATCATTCTGGTAGG - Intronic
1073976777 10:109110934-109110956 TTCATGTTTATTATCTTGGCAGG + Intergenic
1074684924 10:115952320-115952342 ATCAAGTTTATTATCTTGGTGGG + Intergenic
1074995095 10:118749947-118749969 TTCGAGTTTATTACTTTGGTAGG - Intronic
1078943032 11:16030793-16030815 TTTTTGTTTATCATCTTTGTGGG - Intronic
1079451091 11:20600522-20600544 ATTTAGTTTATTATCGTTGTAGG + Intronic
1079749515 11:24179435-24179457 TGCTAGTTTATTTTTGTGGTGGG + Intergenic
1079911834 11:26319359-26319381 TACTAGGTTATTAACTTGGGTGG - Intronic
1080575397 11:33594318-33594340 TTTTAGCTCATTATTTTGGTGGG + Intronic
1081337203 11:41881690-41881712 TTCTAATTTACTATCTTGGTTGG + Intergenic
1082173189 11:49030974-49030996 TTCTTGTTTATTTGGTTGGTGGG + Intronic
1082728223 11:56763245-56763267 TTCTACTTTGTTCTCTTTGTTGG - Intergenic
1082766572 11:57173156-57173178 TATTATTTTATTATTTTGGTAGG - Intergenic
1086646183 11:89223414-89223436 ATAGAGTTTATTTTCTTGGTTGG - Intronic
1086996243 11:93359694-93359716 TAAAAGTGTATTATCTTGGTAGG - Intronic
1087528406 11:99348337-99348359 TTCTAGTGTATTTTTTTGGGGGG - Intronic
1088615850 11:111627193-111627215 TTCTATTTTAATATCTTCATGGG - Intronic
1088854297 11:113732941-113732963 TTAAATTTTATTTTCTTGGTTGG - Intergenic
1089593860 11:119562475-119562497 TTGTATTTTTTTATCTTTGTTGG - Intergenic
1090124472 11:124071414-124071436 TTCTAATTTCTGATTTTGGTAGG + Intergenic
1090928226 11:131271498-131271520 TTGTCGTTTTTTATCTTTGTTGG + Intergenic
1093156493 12:15692153-15692175 TTTTACTTTTTTATTTTGGTAGG + Intronic
1093536830 12:20232133-20232155 TTTTTGTTTATTATTTTGATTGG - Intergenic
1094743327 12:33314550-33314572 TTCAAGTTTAGAATCATGGTAGG - Intergenic
1095164316 12:38954003-38954025 TTGTATTTTATTTTCTTGGCTGG + Intergenic
1095633149 12:44401252-44401274 TTTTAATTTGTTATCTTGGCTGG - Intergenic
1095910677 12:47423694-47423716 TTCTATTTTATTCTCAGGGTAGG - Intergenic
1097405872 12:59189307-59189329 TTATTGTTTCTTATCTTTGTGGG + Intergenic
1098201597 12:68062234-68062256 TTGTCTTTTTTTATCTTGGTTGG + Intergenic
1098458266 12:70701446-70701468 TTCTCTTTTAGTATCATGGTTGG + Intronic
1099975260 12:89540068-89540090 TTGTAGTTTACTATCTTGACTGG - Intergenic
1101163770 12:102006990-102007012 TTCTGGTTTGCTATCTTGGCTGG - Intronic
1102860192 12:116329757-116329779 TTCTAGTTTGTTTGTTTGGTTGG + Intergenic
1103889250 12:124226263-124226285 TTTTCGTTTTTTTTCTTGGTGGG - Intronic
1105052269 12:133065198-133065220 TTCTTATTTACTATCTTGGGTGG + Intergenic
1105734604 13:23255008-23255030 TTCTAGTACAGTATCTTTGTGGG - Intronic
1106197315 13:27504867-27504889 TTATGGTTTATTATCCTGTTTGG + Intergenic
1106919725 13:34550686-34550708 TTCTAGGTAATTCTCTTGGGAGG - Intergenic
1108179983 13:47831033-47831055 TTCAAGTTTATTTTCTTTCTAGG - Intergenic
1109105164 13:58241024-58241046 TTCTTGTTTATTATCTTGCAGGG - Intergenic
1109669192 13:65582876-65582898 TTCTAAATTATTATTTTAGTAGG - Intergenic
1109898661 13:68731683-68731705 TAATAGTTTATTATTTTGTTAGG + Intergenic
1111014255 13:82356100-82356122 TTCTAGTTTAATGTCTTGTCTGG + Intergenic
1112068240 13:95817830-95817852 TTCTAGTTTAATTTCATGATGGG - Intronic
1113006631 13:105711374-105711396 TTCTAGTTTCTTAAGTTGGAAGG + Intergenic
1113142416 13:107169107-107169129 TTGTATTTTATTTTCTTTGTGGG - Exonic
1113157810 13:107344820-107344842 TTCTACTATTTTATCTTGGTAGG - Intronic
1113164426 13:107422751-107422773 TTATCCTATATTATCTTGGTGGG + Intronic
1114855739 14:26440319-26440341 TTATAATGAATTATCTTGGTTGG + Intergenic
1116143322 14:41030204-41030226 TTTTAGTTTATTATTTTGTGTGG - Intergenic
1117430195 14:55650260-55650282 TGCTATTTTTATATCTTGGTGGG + Intronic
1120360628 14:83497162-83497184 TTCTAGTTGTTTATCAGGGTTGG + Intergenic
1120421221 14:84288539-84288561 TACAAGTTTAATATATTGGTTGG - Intergenic
1122085440 14:99298274-99298296 TTCTCTCTTTTTATCTTGGTTGG - Intergenic
1122331415 14:100917987-100918009 ATCTAGTGTATTATCTCTGTGGG + Intergenic
1122331570 14:100919792-100919814 ATCTAGTTGATTATCTCTGTGGG + Intergenic
1122360561 14:101159265-101159287 TTCTAGATTATTAAATTTGTAGG + Intergenic
1122380681 14:101304349-101304371 TTCTAGGTTATTATATTTGTGGG - Intergenic
1124020445 15:25917162-25917184 TTCTAGGTTATCAAATTGGTTGG + Intergenic
1124127881 15:26954224-26954246 TTCCAGTTTATTATATTAGGAGG + Intergenic
1124474497 15:30021079-30021101 TTGTCTTTTTTTATCTTGGTTGG - Intergenic
1124930171 15:34112104-34112126 TTTTATTTTATTTTTTTGGTGGG + Intergenic
1125742696 15:41977982-41978004 TTCTTATTTATTATTTTTGTAGG + Intergenic
1125980116 15:43993084-43993106 TTCTAGTTTCATACTTTGGTGGG + Intronic
1126136492 15:45397333-45397355 TCCAAGTTTATGATCATGGTTGG - Intronic
1126217474 15:46172960-46172982 TTCTAGTTAAGTATCTTTGAAGG + Intergenic
1127587808 15:60395147-60395169 TACTAGTTTCTAAACTTGGTGGG - Intronic
1129123725 15:73420174-73420196 TTCTAATTTACTATCTTGGTTGG + Intergenic
1129352096 15:74961866-74961888 TTCCAGTTTATTATATTAGTTGG + Intronic
1131539956 15:93267693-93267715 CTCTTGTTTCTTTTCTTGGTAGG + Intergenic
1135237639 16:20773083-20773105 TTCAGGTTTTCTATCTTGGTAGG + Intronic
1135659833 16:24286630-24286652 TACTAGTGTATTACCTGGGTGGG - Intronic
1141041158 16:80673813-80673835 TTATCCTGTATTATCTTGGTTGG + Intronic
1141122281 16:81369296-81369318 TTCTGGTTTTCTATTTTGGTAGG - Intronic
1141289613 16:82705596-82705618 TTCTTATTTATTTTTTTGGTAGG + Intronic
1141751965 16:85964496-85964518 TTCTCGTGGATTATCTGGGTAGG + Intergenic
1141877013 16:86832442-86832464 TTGTCGTTTTTTATCTTTGTTGG + Intergenic
1143634914 17:8159100-8159122 TTCTATTTTTTTTTTTTGGTTGG - Intronic
1144001462 17:11058988-11059010 TTCTAATTTACCATCTTGATTGG - Intergenic
1147354283 17:39881321-39881343 TTATATTTGATTATCTTGGTGGG + Intergenic
1147883881 17:43671459-43671481 TTCTATTTTATTCTCCTGCTTGG - Intergenic
1154068187 18:11128993-11129015 TAATAGTTTATTTGCTTGGTTGG + Intronic
1154505917 18:15040723-15040745 TGATAGTTTATTTGCTTGGTTGG + Intergenic
1155642447 18:28035041-28035063 CTCGAGTTTATCATTTTGGTAGG + Intronic
1155761736 18:29576481-29576503 TTATTTTTTATTATCCTGGTAGG - Intergenic
1155976217 18:32134205-32134227 TTCTATTTTATTTTTTTGTTAGG + Intronic
1156145990 18:34179282-34179304 TTCTAGTTTATTAAGGTGGAAGG - Intronic
1156629597 18:38951159-38951181 TGCTACTTTATTATTTAGGTTGG - Intergenic
1157049627 18:44147112-44147134 TTATATTTTATTTTCTTTGTTGG - Intergenic
1158254585 18:55531451-55531473 TTCTATTTTGCTATCTTTGTTGG - Intronic
1160203384 18:76813487-76813509 TGTAAGTTTATTATCTTGATTGG + Intronic
1165222387 19:34327286-34327308 TTCTAGTTTATTTGCTTAGATGG + Intronic
925592292 2:5521994-5522016 TTAATATTTATTATCTTGGTGGG + Intergenic
926122247 2:10249566-10249588 TTATTGTTTTTTTTCTTGGTTGG + Intergenic
927252618 2:21011357-21011379 TTTTATTTCATTATTTTGGTAGG + Exonic
930932685 2:56906533-56906555 TTCTTGTTTCTTATTTTGGGGGG + Intergenic
931074202 2:58690877-58690899 TTCTCTTTTTTTATCTTTGTTGG - Intergenic
931887952 2:66638310-66638332 TTCTACAGTATTATCTTTGTGGG + Intergenic
932147889 2:69340112-69340134 TAATAGTTTATTATTTTAGTTGG + Intronic
933233653 2:79839659-79839681 TTCTAGTTTTTTTTCTTAGCTGG + Intronic
933340249 2:81016362-81016384 TTATAGTATATTTTCTTTGTAGG - Intergenic
934312488 2:91880409-91880431 TTATATTTTATTATTTTGGGAGG - Intergenic
934634128 2:95966900-95966922 TGCTATTTTATTCTCTTTGTAGG + Intronic
935030510 2:99317381-99317403 TTCTTGTTTAGTTTCTTGGCTGG + Intronic
936707584 2:115093034-115093056 TTCTAGCTTTTTATCTTAATGGG - Intronic
937838252 2:126496066-126496088 TTCTAGTTTTCTATCTTTTTGGG - Intergenic
938878750 2:135562488-135562510 ATCTAGATTATAATTTTGGTAGG + Intronic
938923480 2:136017323-136017345 GTCTTGCTTATTCTCTTGGTGGG + Intergenic
940745442 2:157562451-157562473 TTTTATTTTATTTTTTTGGTTGG - Intronic
941125323 2:161577510-161577532 TATTATTTTATTATCTTGTTTGG + Intronic
941305148 2:163855272-163855294 TTCTATTTTTTTATCTTTATGGG + Intergenic
941527687 2:166626972-166626994 TTGTATTTTTTTATCTTTGTTGG + Intergenic
943228659 2:185215085-185215107 TTCTTGTTTATTATCTTACAGGG + Intergenic
943236187 2:185322899-185322921 TTCTAGTTTTTTACCATTGTTGG - Intergenic
943458103 2:188132972-188132994 CTTTACTGTATTATCTTGGTTGG - Intergenic
943862430 2:192885185-192885207 TCCTACTTCATTATCTAGGTTGG - Intergenic
944129917 2:196336749-196336771 TTCTACTTTGTCATCTGGGTTGG - Intronic
944315729 2:198284030-198284052 TTCTTGTTTATTGTTTAGGTTGG + Intronic
945906739 2:215602315-215602337 TTCTTTTTTATTTTCTTAGTGGG + Intergenic
945987583 2:216367719-216367741 TTCTTGTTCATTATTTTGATGGG - Intronic
946214203 2:218171186-218171208 TACTAGTTTGTGATCTTGGGTGG + Intergenic
946537941 2:220651654-220651676 TTCTGCTTTCTTCTCTTGGTCGG + Intergenic
946620498 2:221556813-221556835 TTCTATTTTATTATTGTTGTTGG + Intronic
946975538 2:225145353-225145375 TTCTAGCTTATTAAATTTGTTGG - Intergenic
947017673 2:225639314-225639336 TTTAAGTTTATTACCTTTGTGGG + Intronic
1169659527 20:7962840-7962862 TTCTACTTTATTATTATGGAGGG + Intergenic
1169711743 20:8571926-8571948 TTCTATTTTAGTATCTTTATTGG - Intronic
1169902581 20:10568658-10568680 TTTTAGTTTACAATTTTGGTGGG + Intronic
1170273028 20:14549323-14549345 TTCTATTTCATTATTTTGTTAGG - Intronic
1170412174 20:16103709-16103731 TTATAGTGTATTATCATTGTTGG - Intergenic
1170778118 20:19397391-19397413 AACTAGTTTCTTATCTTGATTGG - Intronic
1170797243 20:19559243-19559265 TTCTTGTTCATTATCTTTTTGGG + Intronic
1172379725 20:34478867-34478889 TGCTAGTTTATTTTCTTATTAGG - Intronic
1176791944 21:13328303-13328325 TGATAGTTTATTTGCTTGGTTGG - Intergenic
1180539242 22:16426244-16426266 TTATATTTTATTATTTTGGGAGG - Intergenic
1181675717 22:24450404-24450426 TTCAAATTTATAGTCTTGGTAGG - Intergenic
1182940729 22:34274659-34274681 TTCTGGTTTCTTCTCTGGGTTGG - Intergenic
1185008003 22:48296422-48296444 TTCTCCCTTATTTTCTTGGTTGG - Intergenic
950953265 3:17023739-17023761 TTCAAGTCTATCATTTTGGTGGG + Intronic
951071694 3:18336907-18336929 TTCTAGTTTCTTATTTTTGGTGG - Intronic
951725757 3:25756805-25756827 CACTAGTTTATTTTCTTTGTTGG - Intronic
951927122 3:27920524-27920546 TTCTAGTTTCTTAACTTTTTTGG + Intergenic
954048757 3:47954969-47954991 TTCTGGCTTAATATCTTAGTAGG - Intronic
954887465 3:53888701-53888723 TACTGGTTTATAAACTTGGTGGG + Intronic
955140657 3:56266022-56266044 TTTTATTTTATTTTTTTGGTCGG - Intronic
957153299 3:76514368-76514390 TACTAGTTTATTCTCATGTTTGG - Intronic
957401369 3:79719342-79719364 TTTTAGTCTATTATATTGGTGGG - Intronic
957918991 3:86724038-86724060 TTCTTGTATAGTATCTTGCTGGG + Intergenic
958029909 3:88096151-88096173 TTCTACTTAATTATCTAGGATGG - Intronic
958463875 3:94433955-94433977 TTTTATTCTATTAGCTTGGTAGG + Intergenic
960193958 3:114742187-114742209 TTCAAGTTTTTAATCTTGGTGGG + Intronic
961111621 3:124288740-124288762 TTGTAATTTATTATCTAGGCAGG + Intronic
962180787 3:133204188-133204210 TTCTTTTTTATTAGCCTGGTTGG + Intronic
962558328 3:136578956-136578978 TTCTAGTTTATTATCTTGGTAGG - Intronic
963288053 3:143456515-143456537 TTGTAGTTTATTTTTTTGGAAGG + Intronic
963948847 3:151176610-151176632 TTCCAGTTAATTATCTGGGTGGG + Intronic
964209537 3:154211713-154211735 TTCTATTCCATTATCTTAGTTGG + Intronic
965009257 3:163064621-163064643 GTCTAGTGTATTATCTTGCAGGG - Intergenic
966031403 3:175352488-175352510 TTCAAGTTTCTTACCTTGTTAGG + Intronic
967039731 3:185680183-185680205 TTCTAGGTTATTAAATTTGTAGG - Intronic
967193915 3:187010317-187010339 TTTTAGTCTATTAATTTGGTGGG + Intronic
968906583 4:3455477-3455499 TAATAGTTTATTTGCTTGGTTGG + Intergenic
969906390 4:10400477-10400499 TTCTATTTTATTATTTGGCTTGG + Intergenic
970247955 4:14083189-14083211 TTTTATTTTTTAATCTTGGTAGG + Intergenic
970734984 4:19155314-19155336 GTCTTTTTTATTATCTTTGTTGG + Intergenic
971884020 4:32419678-32419700 TTCTAGTTTATTCAGTTTGTTGG + Intergenic
972121746 4:35712361-35712383 TTCCAGTTTTTTCTCTTGGATGG - Intergenic
972170485 4:36340090-36340112 TTCTAGTTTATTACACAGGTTGG + Intronic
972312594 4:37894789-37894811 TTCTAGTGGATTAGCTGGGTTGG - Intronic
972391787 4:38620644-38620666 TTTTACTTTATTATGTTGTTAGG + Intergenic
972461393 4:39306896-39306918 TTTTAGTTTTTTATTTTGGGTGG - Intronic
972894131 4:43598038-43598060 TTATGGTGGATTATCTTGGTGGG - Intergenic
972991713 4:44828662-44828684 TTCAAGTTGATCATTTTGGTTGG - Intergenic
975480046 4:74867866-74867888 CTCTAGTTTATAATCTAGTTAGG - Intergenic
975490091 4:74978344-74978366 TTGTATTTTTTTATCTTTGTTGG - Intronic
976766105 4:88599363-88599385 TGCTATTTAATTCTCTTGGTGGG + Intronic
977209848 4:94206408-94206430 TTCTCATTTATTATATTTGTGGG + Intergenic
977944685 4:102898446-102898468 TTATATTTTATTATTTTGGGAGG - Intronic
978397126 4:108293176-108293198 TTACAGTTAATTATCTTGGGGGG + Intergenic
979510934 4:121552940-121552962 TTTTGATTTATTATTTTGGTAGG + Intergenic
980319241 4:131247313-131247335 TTCTAGTGTATTAATTTGCTAGG + Intergenic
980412229 4:132436267-132436289 TTCTAGTATATGATCTTAATGGG - Intronic
980450808 4:132968757-132968779 TTCTTGTTTATTCTCTTAGCTGG + Intergenic
980566147 4:134545438-134545460 TATAAGTTTATTATTTTGGTGGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981116476 4:140996686-140996708 TTCTAGCTTATGATCTAGTTAGG + Intronic
983089952 4:163491625-163491647 TTCTCCTTTATTTTCTTAGTTGG + Intergenic
983115691 4:163813360-163813382 AACTATTTTATTATCCTGGTTGG + Intronic
983247901 4:165309816-165309838 TCCTAGTTTATCATGTTAGTGGG - Intronic
983332348 4:166347008-166347030 TTCTAATTTATCATCTTTTTTGG + Intergenic
983420082 4:167506329-167506351 TTCGAGTTTTTCATCTTTGTGGG + Intergenic
983451027 4:167911751-167911773 TTCTAGTTTATTTGCTTAGAGGG + Intergenic
984135808 4:175936652-175936674 TTCTGGTTTGATATCTTGTTAGG - Intronic
984189062 4:176582947-176582969 TTCTGGTTTATAAGATTGGTTGG + Intergenic
984613459 4:181867931-181867953 TTCTGGTATATTTTCTTGGAGGG + Intergenic
985038351 4:185863579-185863601 TTCAAGTTTTTTATCTTGCCAGG + Intronic
985891531 5:2719486-2719508 TTCTAGTCTATTGTCTTTGTCGG + Intergenic
987499348 5:18687073-18687095 CTCTATTTGTTTATCTTGGTTGG + Intergenic
987904500 5:24058483-24058505 TTTTGGTTTATTATTTTGTTAGG - Intronic
988767456 5:34396083-34396105 AACTAGTTTATTTTCTTTGTAGG - Intergenic
988898639 5:35707150-35707172 TTTTAGTTTTTTAACTTAGTCGG - Intronic
989316520 5:40086643-40086665 TTCTAGTATATTAACTGGGATGG - Intergenic
989618787 5:43364820-43364842 TTGTATTTTTTTATCTTTGTTGG + Intergenic
990662850 5:58037811-58037833 TTATACTGTATTATCTGGGTGGG + Intergenic
990752146 5:59028400-59028422 TTTTATTTTATTATTTTGGGGGG - Intronic
991019475 5:61964893-61964915 TTCTGGTTTACTCTCTTGGGAGG - Intergenic
991126911 5:63079974-63079996 TTCCAGTTGATTACTTTGGTTGG + Intergenic
991284460 5:64956103-64956125 TTCTAGATTGTTATGTTGTTTGG - Intronic
992132876 5:73711865-73711887 TTCTTGCTTTTGATCTTGGTGGG + Intronic
993297623 5:86162446-86162468 TTCTAGTTTTCTTTCTTGTTTGG - Intergenic
993361128 5:86977735-86977757 TTCTAGGAAATTATCTTGATGGG + Intergenic
994072326 5:95617037-95617059 TCCTGGTTTATTTTCTTGCTTGG - Intergenic
995313763 5:110742396-110742418 TTCTAAATTATTATTTTGATGGG - Intronic
995791299 5:115891175-115891197 TTTTAGTTTAATTTTTTGGTAGG - Intronic
996297596 5:121940895-121940917 TTCTTGTTTAATATCATGGATGG + Intergenic
996312382 5:122121471-122121493 TTATTGTTTATTTTCTTGGATGG - Intergenic
996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG + Intronic
996558417 5:124802396-124802418 TTCCAGTTTAGTATCTTGGAGGG + Intergenic
998384908 5:141751511-141751533 TTCTAGTAAATTATGTTTGTGGG - Intergenic
999883088 5:155889295-155889317 TTCTCATTTATAATCTTTGTAGG + Intronic
1003877268 6:10449906-10449928 AGCCAGTTTATTATCTGGGTGGG - Intergenic
1004358982 6:14954327-14954349 TCCTTGTTTATTAGCTTGGAGGG - Intergenic
1005306056 6:24515346-24515368 TTCTAATATTTTATCTTGATAGG + Intronic
1005469489 6:26148294-26148316 TTCTAGTTTTTTTTCTTTATAGG - Intergenic
1005768916 6:29045054-29045076 TTCTACTTAATTACATTGGTGGG - Exonic
1006270418 6:32961384-32961406 TTCTATTTTGTTTTTTTGGTGGG - Intronic
1006912842 6:37575249-37575271 CTCCATTTTAATATCTTGGTAGG + Intergenic
1007233753 6:40374885-40374907 TTCTAGTTTATTATATACTTAGG - Intergenic
1008499110 6:52162635-52162657 TTCTAGTTTATTCTCCTTGTTGG + Intergenic
1008722616 6:54375080-54375102 TTTTATTTTATTATGATGGTAGG - Intronic
1009883158 6:69594708-69594730 GCCTAGTTTATTATTTTGTTAGG + Intergenic
1010613292 6:77983125-77983147 TTCTAGTTGCTTATCTTCATGGG - Intergenic
1010647426 6:78407598-78407620 TTCTATTTTATTGTATTTGTTGG - Intergenic
1010760304 6:79714875-79714897 TTCTAGATTATTACGTGGGTGGG - Intergenic
1010782610 6:79961930-79961952 ACCTACTTTATTATATTGGTGGG - Intergenic
1010905213 6:81478827-81478849 TTTTAATGTATTATCTTGGCTGG + Intergenic
1010975829 6:82312779-82312801 TTCTACTTTAATATTTTGCTTGG - Intergenic
1011145005 6:84204945-84204967 TTCTAGTTTATTTGCTTAGGGGG - Intronic
1011865372 6:91819469-91819491 TTTGTGTTTATTATCTTTGTAGG - Intergenic
1012120650 6:95362234-95362256 TTTCAGTTTATTTTCTTGGGTGG - Intergenic
1012301119 6:97589167-97589189 TTATAGTTTTTTTTCTTGGCAGG + Intergenic
1012328426 6:97953621-97953643 TTCTAGATTATGAACTTTGTGGG + Intergenic
1013671100 6:112403869-112403891 TTCCAGTTTCTTATTTTGGGGGG + Intergenic
1013750773 6:113403367-113403389 TTTAAGTTTATTAGCTTGGAAGG - Intergenic
1013795112 6:113879147-113879169 TTCTTGTTTAAATTCTTGGTTGG + Intergenic
1014388980 6:120837204-120837226 TTCTAGTTCATAGTCTTGTTAGG - Intergenic
1014480254 6:121927543-121927565 TTCTATTTTATTAGCTTCATTGG - Intergenic
1014499847 6:122172825-122172847 TTCTATTTTATTATTTTTGATGG - Intergenic
1014641638 6:123918084-123918106 TTCTTGTTTATTGTATTTGTGGG + Intronic
1014971293 6:127818467-127818489 TTATAGTTTACTATAATGGTAGG - Intronic
1015627445 6:135195049-135195071 TTCTCTTTTATTGTCTTTGTTGG - Intronic
1016332680 6:142970243-142970265 TTCAAGTTTATTTTCTTTTTTGG + Intergenic
1016708236 6:147138847-147138869 TTCTAGTTCTTTATCTTCTTTGG - Intergenic
1016759825 6:147724778-147724800 TTCTAATTCAATATCTTGCTTGG - Intronic
1018401081 6:163420808-163420830 ATATAGTTTGTTATCTTAGTGGG + Intronic
1018502429 6:164425539-164425561 TTTTGGTTTATTATCTTGATGGG - Intergenic
1018578491 6:165285192-165285214 TTGTATTTTTTTATCTTTGTTGG - Intronic
1021071897 7:16251105-16251127 TTGTATTTTTTTATCTTTGTTGG - Intronic
1021874608 7:25036873-25036895 TTCTATTCCATGATCTTGGTTGG - Intergenic
1023213839 7:37838513-37838535 TTCTATTTTATTATTCTAGTAGG - Intronic
1023557913 7:41442611-41442633 TGCTAGTTTATTATCATGCTTGG - Intergenic
1023903157 7:44500456-44500478 TTCTACTTTATAACCTTTGTTGG - Intergenic
1024595809 7:50936321-50936343 TTCTAGTTGTTTATCATGGGAGG + Intergenic
1024713001 7:52039153-52039175 TTCTATGTAATTATCTTGTTTGG - Intergenic
1024874148 7:54002426-54002448 TTCTAGTTCTGTATTTTGGTAGG - Intergenic
1024975470 7:55110350-55110372 TTCTGCTTTATTATCTTCTTGGG - Intronic
1026103735 7:67404089-67404111 CTCTAGTTTATTTTCCTGCTGGG + Intergenic
1026139422 7:67692720-67692742 TTCTTGTTTGTTTGCTTGGTTGG - Intergenic
1028884063 7:95911831-95911853 TTCTAATTTATCTTATTGGTAGG - Intronic
1029960967 7:104688995-104689017 TAGTAGTTTATTTGCTTGGTTGG + Intronic
1030501117 7:110360590-110360612 GTCTAGTTTATTCTATTTGTTGG + Intergenic
1031574800 7:123402043-123402065 TTGGAGTTTTTTATCTTGTTTGG - Intergenic
1031893985 7:127326964-127326986 TTCCAGGTTATTCTCATGGTAGG + Intergenic
1034761930 7:153680625-153680647 TTCTGGTGTACTAGCTTGGTAGG + Intergenic
1037113481 8:15195039-15195061 TTATAGTTTATTTTTTTGGATGG - Intronic
1038298126 8:26315334-26315356 TTCTAGTGTCTTATCTCAGTGGG + Intronic
1038851469 8:31281573-31281595 TTTTGGTTTAATATTTTGGTAGG + Intergenic
1039267828 8:35845846-35845868 TTCTAGTTTATTCAATTTGTTGG - Intergenic
1039368204 8:36955527-36955549 TCCTGCTTTACTATCTTGGTAGG + Intergenic
1040347752 8:46525184-46525206 TTCTAGTTTTTTTTTTTTGTAGG - Intergenic
1040355259 8:46611292-46611314 TTCTGGTATATTGTCTTGGGAGG - Intergenic
1041016629 8:53598028-53598050 TTCTGATTTATTATCTTGGCTGG - Intergenic
1041596082 8:59654628-59654650 TTCTAGTTTATGAAATTTGTTGG - Intergenic
1042562639 8:70084486-70084508 TTAAAGTTTTCTATCTTGGTGGG - Intergenic
1043501664 8:80864303-80864325 TTATAATTTATTTTCTTGGTGGG - Intronic
1044077327 8:87838828-87838850 TTCTAGTTTATTATTTTTTGTGG - Intergenic
1044497893 8:92912709-92912731 TTCTAGTTTATTCAATTTGTTGG - Intronic
1044515846 8:93137439-93137461 TCATATTTTATTATCTTGCTGGG + Intronic
1044721606 8:95155039-95155061 TTTTAGGTTATTTTCTTGGAAGG + Exonic
1045781654 8:105871682-105871704 TGCTAGTTCACTATCATGGTAGG + Intergenic
1045813227 8:106248866-106248888 TTCTAGTGTATTTTCTATGTTGG - Intergenic
1046121029 8:109847517-109847539 TTCAGGTTTTCTATCTTGGTAGG + Intergenic
1047977204 8:130142363-130142385 TTCTATTTTAATATCTTCTTGGG + Intronic
1048351460 8:133619961-133619983 TTCTAATTAATTATTGTGGTGGG + Intergenic
1051966132 9:22832086-22832108 TAATAGTTTATTTTCTTGGTTGG + Intergenic
1052001982 9:23295210-23295232 TGCTAGTTTAACATTTTGGTAGG - Intergenic
1052544315 9:29853949-29853971 TTCTAGTCCATTACCTTAGTGGG - Intergenic
1054998845 9:71425513-71425535 TTCTAATGTATTTTCGTGGTGGG - Intronic
1055046298 9:71928555-71928577 TTATAGTTTAATATGTTGGAAGG + Intronic
1055909895 9:81337191-81337213 TTCTATTTATTTATCTTGCTTGG - Intergenic
1057319551 9:93999975-93999997 TTCTGGTTTACTATCCTGGTAGG + Intergenic
1058158418 9:101540743-101540765 TTCCAGTTTATAATTTTGGGGGG + Intronic
1058209225 9:102146719-102146741 TTCTAGTTTATTATTGTTCTAGG + Intergenic
1058220995 9:102302148-102302170 TTCTAGTATATAATTTTGGAAGG + Intergenic
1060027175 9:120183180-120183202 ATCTAGTGTCTTATGTTGGTTGG + Intergenic
1060095328 9:120784159-120784181 TTTAAGATTATTCTCTTGGTGGG - Intronic
1060570191 9:124631607-124631629 TTTTAGTTTTTTGTCTTTGTGGG - Intronic
1188870997 X:35371923-35371945 TTCTAGTTTTTAATTTTTGTGGG + Intergenic
1188966524 X:36560397-36560419 GTCCAGTTTATTATTTTTGTAGG + Intergenic
1189681220 X:43518740-43518762 TTATGATTTATTATCCTGGTAGG + Intergenic
1190924483 X:54889888-54889910 TTCTCTTTTTTTATCTTTGTTGG - Intergenic
1191064678 X:56335242-56335264 TTCTCTTTTATGATCTTTGTTGG + Intergenic
1191962720 X:66720981-66721003 TTGTCGTTTTTGATCTTGGTTGG - Intergenic
1191966853 X:66768086-66768108 TTATACCTTATTATTTTGGTTGG - Intergenic
1192088515 X:68127015-68127037 TTTTAGTTTGTTCTTTTGGTTGG - Intronic
1193453086 X:81695070-81695092 TTGTCTTTTATGATCTTGGTTGG + Intergenic
1194141143 X:90211409-90211431 TTCTAGATTATCATATTTGTTGG - Intergenic
1194252690 X:91597609-91597631 TTCTAGGATATTATCTTGTCAGG - Intergenic
1194961200 X:100237714-100237736 TTCTATTTTATTATATTCTTGGG + Intergenic
1195729356 X:107950207-107950229 TTCTATTGGATTTTCTTGGTAGG + Intergenic
1195889852 X:109680939-109680961 TCCAAGTTTGTTATTTTGGTAGG - Intronic
1196238789 X:113315393-113315415 TACAACTTTATTATTTTGGTAGG + Intergenic
1196395010 X:115250346-115250368 TTCTATTTTATCTTCTTTGTTGG - Intergenic
1196913027 X:120502949-120502971 TTCTATTTTATTGCCTTTGTTGG - Intergenic
1197162374 X:123338413-123338435 TTCATGTTTATTGTCTTTGTGGG - Intronic
1198612319 X:138415879-138415901 TGCAAGTTTATTATATAGGTAGG + Intergenic
1198942383 X:141970786-141970808 GCCTAGTTTATTATCTTGTTAGG + Intergenic
1200486901 Y:3780523-3780545 TTCTAGATTATCATATTTGTTGG - Intergenic
1200571626 Y:4838867-4838889 TTCTAGGATATTATCTTGTCAGG - Intergenic
1201180448 Y:11337899-11337921 TTATATTTTATTATTTTGGGAGG - Intergenic