ID: 962558636

View in Genome Browser
Species Human (GRCh38)
Location 3:136582478-136582500
Sequence TATGATCCAAATTTAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962558636_962558638 -1 Left 962558636 3:136582478-136582500 CCAGGCTTTAAATTTGGATCATA 0: 1
1: 0
2: 1
3: 19
4: 181
Right 962558638 3:136582500-136582522 ATAAATTAGCAATTCCAGGCTGG 0: 1
1: 1
2: 1
3: 32
4: 307
962558636_962558640 5 Left 962558636 3:136582478-136582500 CCAGGCTTTAAATTTGGATCATA 0: 1
1: 0
2: 1
3: 19
4: 181
Right 962558640 3:136582506-136582528 TAGCAATTCCAGGCTGGGCACGG 0: 1
1: 2
2: 22
3: 221
4: 1363
962558636_962558641 8 Left 962558636 3:136582478-136582500 CCAGGCTTTAAATTTGGATCATA 0: 1
1: 0
2: 1
3: 19
4: 181
Right 962558641 3:136582509-136582531 CAATTCCAGGCTGGGCACGGTGG 0: 4
1: 22
2: 274
3: 1755
4: 8230
962558636_962558637 -5 Left 962558636 3:136582478-136582500 CCAGGCTTTAAATTTGGATCATA 0: 1
1: 0
2: 1
3: 19
4: 181
Right 962558637 3:136582496-136582518 TCATATAAATTAGCAATTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 241
962558636_962558639 0 Left 962558636 3:136582478-136582500 CCAGGCTTTAAATTTGGATCATA 0: 1
1: 0
2: 1
3: 19
4: 181
Right 962558639 3:136582501-136582523 TAAATTAGCAATTCCAGGCTGGG 0: 1
1: 0
2: 2
3: 48
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962558636 Original CRISPR TATGATCCAAATTTAAAGCC TGG (reversed) Intronic
900275162 1:1821132-1821154 TTTCATCCTAAATTAAAGCCTGG + Intronic
904895803 1:33817208-33817230 TATCATCCAAGTTCAAACCCAGG + Intronic
907820401 1:57962095-57962117 AATGATCCCAATTCAAATCCTGG + Intronic
908412093 1:63877145-63877167 TATGAACAAAACTGAAAGCCAGG - Intronic
909833566 1:80224913-80224935 TATTATAAAAATTTAAGGCCGGG - Intergenic
913070929 1:115297918-115297940 GGTGATCCCAATATAAAGCCAGG + Intronic
913374030 1:118131570-118131592 GTTGATCTAAATTCAAAGCCTGG + Intronic
916008702 1:160685020-160685042 TTGAATCCAAATTTAAAGGCAGG - Exonic
916523805 1:165590439-165590461 TATCATCCAAATTAGAAGCCTGG + Intergenic
918989021 1:191673798-191673820 TAAGAACAAAATTTATAGCCTGG - Intergenic
920590901 1:207217630-207217652 CATGCTCAAAAATTAAAGCCAGG + Intergenic
920592631 1:207235870-207235892 TATGTTTCAAATTTAAGTCCAGG - Intergenic
923371134 1:233314198-233314220 TATCATATAAATTTAAAGGCAGG - Intergenic
1066341124 10:34534713-34534735 TATCATCCTAATTTAGGGCCAGG + Intronic
1069217422 10:65839392-65839414 TATGACCCAAGTTTAAGTCCTGG - Intergenic
1069593384 10:69655485-69655507 AAAGATACAAATTTAGAGCCTGG + Intergenic
1071063420 10:81601277-81601299 TATTATGCAAATATAAAGCAAGG + Intergenic
1072004411 10:91230458-91230480 TATGTCAAAAATTTAAAGCCAGG + Intronic
1075434386 10:122422672-122422694 TCTGATCCAGAGTTAAATCCAGG - Intronic
1081168098 11:39831531-39831553 TATGATGCAAATCTAAAGCACGG + Intergenic
1082929481 11:58585797-58585819 TATAAGGCAAGTTTAAAGCCTGG + Intronic
1084678503 11:70651087-70651109 TATGATCCAGGTTTGAATCCAGG - Intronic
1085670293 11:78457863-78457885 TTTTATCAAAATTTAAAGTCAGG + Intronic
1085782921 11:79425554-79425576 ACTGATCCAAATTCAAATCCTGG + Intronic
1086047723 11:82552455-82552477 TATTAAGCAAATTTAAAACCTGG - Intergenic
1086498103 11:87424827-87424849 TAGAATCCAGATTTAAACCCAGG + Intergenic
1087949712 11:104205752-104205774 TATGATCCAAATATAAACAATGG - Intergenic
1087995127 11:104796855-104796877 TACTATCCAAATTGAAAACCTGG + Intergenic
1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG + Intergenic
1088303723 11:108386307-108386329 TAACATCCAAATTTAAAGCATGG + Intronic
1089975101 11:122725263-122725285 TAAAATCCAAATTTGAGGCCGGG - Intronic
1091077409 11:132633438-132633460 TCTGATAGAAATTAAAAGCCGGG + Intronic
1094300714 12:28962133-28962155 TATAATCCAACTTCAGAGCCTGG - Intergenic
1099615084 12:84923971-84923993 TATGAGAAAAACTTAAAGCCAGG + Intergenic
1099647554 12:85378778-85378800 TCTGATCCAGATTTAAAGGGAGG - Intergenic
1100409251 12:94298415-94298437 TATGAACCAAATCTAAACCTGGG + Intronic
1101732086 12:107435037-107435059 ACTGCTCCAAAATTAAAGCCAGG - Intronic
1106381450 13:29243850-29243872 GATGATCCTAATTTATAGCCAGG + Intronic
1107676181 13:42799642-42799664 TATGATCAAAAGGTAAGGCCTGG + Intergenic
1110935059 13:81277400-81277422 TCAGATACAAATTGAAAGCCTGG + Intergenic
1111236465 13:85415452-85415474 TCTGAAGGAAATTTAAAGCCTGG - Intergenic
1112243987 13:97712024-97712046 TAAGAAACACATTTAAAGCCAGG + Intergenic
1117806725 14:59500082-59500104 AATGATACAAATTTAAGACCTGG - Intronic
1117926154 14:60781594-60781616 TTTTATCAAAATTTAAGGCCAGG - Intronic
1119117072 14:72033645-72033667 AAAGATCAAAATTTAAAGCATGG + Intronic
1119505315 14:75167695-75167717 TAAGATCCAAATTTTCAGCCAGG + Intronic
1119514427 14:75236849-75236871 TATGATACAAATTTCAAGGGAGG - Intergenic
1119981466 14:79086363-79086385 TAAGATCCCAAGTTAAAGCGAGG - Intronic
1121237385 14:92402428-92402450 TATGATCAAAACTTCCAGCCAGG + Intronic
1126493788 15:49267982-49268004 TATGTACCAAATTAAAATCCTGG - Intronic
1127230562 15:56989144-56989166 TATGATCCTAATTTAAATGTTGG - Intronic
1128543075 15:68550554-68550576 TATGATCCAAGTATAAAGTATGG + Intergenic
1130762542 15:86835261-86835283 TAAGATCTAGATTTTAAGCCAGG - Intronic
1133783728 16:8959082-8959104 TATGCTCCAAATTCCATGCCAGG + Intronic
1135069428 16:19339132-19339154 TCTGATCCAAATATAAAGATTGG - Intergenic
1138928751 16:61625751-61625773 TCTAATCCAAATTTAAAATCAGG + Intergenic
1138934898 16:61706837-61706859 AATGACCCAATTTTTAAGCCAGG - Intronic
1139833370 16:69818866-69818888 TATAGGCCAAATTTAAAGCAAGG - Intronic
1140493427 16:75361319-75361341 TATTGTTTAAATTTAAAGCCGGG + Intronic
1140594277 16:76390634-76390656 ACTGATTCAAATTGAAAGCCTGG + Intronic
1142723363 17:1792895-1792917 AATGATGAAAATCTAAAGCCGGG - Intronic
1146642915 17:34554790-34554812 TAAGACCAAAATTCAAAGCCAGG + Intergenic
1147594216 17:41706238-41706260 GGTGATCCAAATACAAAGCCTGG + Intergenic
1150332113 17:64302733-64302755 TATGATCCCATTTTAGAGCAGGG - Intergenic
1150480785 17:65508044-65508066 TAAAATCAACATTTAAAGCCGGG + Intergenic
1150984332 17:70178350-70178372 TTAGATCCAAATGTAAAGGCAGG + Exonic
1153069892 18:1093188-1093210 TATATTACAAATTTAAAGTCAGG + Intergenic
1153191043 18:2539076-2539098 TTTGCTCGAAATTTACAGCCAGG - Exonic
1154108539 18:11546500-11546522 TATGATCCAAAATTCCAGCCTGG - Intergenic
1156136161 18:34041179-34041201 TATGATATAAATTTGAAGACAGG + Intronic
1156528605 18:37793360-37793382 TATGAATCAAATTAAAAGACTGG - Intergenic
1156864792 18:41876615-41876637 TTAGATCCAAATTCAAGGCCTGG + Intergenic
1158686448 18:59619269-59619291 TGTTTTCCAAATTGAAAGCCAGG + Intronic
1159101486 18:63963655-63963677 TATCATCCAGATTTAATGACAGG + Intronic
1163696394 19:18765663-18765685 TATTATCAAATTTTCAAGCCGGG + Intronic
1165544802 19:36526243-36526265 TATACTTCAAATATAAAGCCAGG + Intronic
1167398885 19:49251694-49251716 AATGATTCAAATATACAGCCTGG + Intergenic
926444841 2:12929401-12929423 AAAGATCTAAATTTAAATCCTGG - Intergenic
928302804 2:30141613-30141635 TATGATCTCAATATAAAGCAAGG + Intergenic
928477781 2:31648504-31648526 TATGGACCAAATTTTATGCCAGG + Intergenic
931011023 2:57913566-57913588 TAAGAGCAAAATTTAAAGTCAGG - Intronic
931012310 2:57930502-57930524 TGTGATACAAAGTTAAAACCTGG + Intronic
931125499 2:59271697-59271719 AATGATCCAGATTCAAATCCTGG + Intergenic
931687272 2:64805251-64805273 TATGATCCACATTTTATACCTGG - Intergenic
934540119 2:95166783-95166805 TCTGATACAAATGTAAAGCCAGG + Intronic
934722562 2:96591466-96591488 TATAATACAAAATTAAAACCAGG - Intergenic
937108883 2:119346869-119346891 TATAGTCCAATTTTACAGCCGGG - Intronic
937462264 2:122099816-122099838 TATATTCCAAATTAAAATCCAGG - Intergenic
938795373 2:134714502-134714524 CCTGATCAAAAGTTAAAGCCAGG + Intronic
942635863 2:178004817-178004839 TATGATGCATATCTACAGCCTGG + Intronic
943678419 2:190741328-190741350 TTTGAACCAAGTTTAAATCCAGG - Intergenic
944566446 2:200996330-200996352 TATGGTAGAAATTTAACGCCAGG + Intronic
945276441 2:207992103-207992125 TGTGATCTAGATTTAAAGTCTGG - Intronic
946756003 2:222948200-222948222 TATGGTCCATATTTTAAGCTAGG - Intergenic
1170653326 20:18262939-18262961 GATGAACCAAATTCCAAGCCAGG + Intergenic
1171037246 20:21725038-21725060 TATTATCCAACTTTCAAGGCTGG - Intergenic
1173323550 20:42011089-42011111 TATGAACAAAGTTAAAAGCCTGG - Intergenic
1173881643 20:46417966-46417988 TATGTTGCAAATGTAAAGTCTGG - Intronic
1173884754 20:46447202-46447224 TATGAGGCAAAATGAAAGCCAGG + Intergenic
1173951366 20:46996000-46996022 TCAGATCCAAATTTAAATCTTGG - Intronic
1175749674 20:61486593-61486615 TAAGATACAAATTTTAGGCCAGG + Intronic
1177952568 21:27556920-27556942 TGTGCTCCAAATTTAAAGATAGG + Intergenic
949390148 3:3552875-3552897 CAGGATCCAAGTTTAAGGCCCGG + Intergenic
952196970 3:31085856-31085878 AATTATCTGAATTTAAAGCCTGG + Intergenic
952827296 3:37534821-37534843 TAAGATCCAAATTCAACTCCTGG - Intronic
953362533 3:42310416-42310438 TGTGATACAAAGTTAAATCCAGG + Intergenic
953730547 3:45443831-45443853 TCAGATCCAAATTTGAAGCCAGG + Intronic
954050450 3:47971284-47971306 TATGATGCCAATTTACAGCGTGG + Intronic
955981502 3:64531973-64531995 AATGATTCAAATGTACAGCCAGG - Intronic
957014885 3:75051615-75051637 TATGCCCCAAATTTAAAGTCTGG + Intergenic
958132285 3:89442930-89442952 TATGTTTGAAATTTAGAGCCTGG - Intronic
958261836 3:91391206-91391228 TAGGATCAAAATTAAAAACCTGG + Intergenic
959824166 3:110773395-110773417 TATGATATTAATTTAAAGCATGG - Intergenic
962051058 3:131815973-131815995 TATAATTCAACTTTAAAGCAAGG - Intronic
962420262 3:135222075-135222097 TAAGATCAAAATTTAAACCCTGG + Intronic
962558636 3:136582478-136582500 TATGATCCAAATTTAAAGCCTGG - Intronic
965964082 3:174466084-174466106 TATGATCCAAATTTAAGAAAGGG + Intronic
967582956 3:191180911-191180933 TATCATCCAAAATTAAATTCTGG - Intergenic
968857400 4:3137204-3137226 TTTGTTTTAAATTTAAAGCCTGG - Intronic
969975777 4:11100031-11100053 TATTATCCATTTTTAAAGACTGG + Intergenic
970423128 4:15923578-15923600 GATTATCCAAATATGAAGCCTGG + Intergenic
972178845 4:36440617-36440639 AATGATCAAAATATAAACCCAGG - Intergenic
974080976 4:57212076-57212098 TATGATCAAAAACTTAAGCCAGG - Intergenic
975034950 4:69668656-69668678 TATGATACAAAGTTAAAAGCAGG - Intergenic
978393963 4:108258268-108258290 TAGGATCCATATTTAGGGCCTGG - Intergenic
979033298 4:115679032-115679054 TAAGAACCAAATTGGAAGCCAGG + Intergenic
981211339 4:142109633-142109655 TCTGATTCATCTTTAAAGCCTGG + Intronic
981235712 4:142413220-142413242 AATGTCCCAAATTCAAAGCCAGG + Intronic
981888619 4:149710032-149710054 AATGATCCAAATTTAATGTCTGG + Intergenic
982568255 4:157014806-157014828 TGTGATCCTGATTTAAAGCCAGG + Intergenic
983745590 4:171194916-171194938 TTTGATAGAAATTTAATGCCTGG + Intergenic
985001582 4:185489726-185489748 TATTATACATATTTAAGGCCAGG - Intergenic
985067765 4:186139862-186139884 TATGATACCCATGTAAAGCCAGG + Intronic
985341167 4:188956082-188956104 TATGATTCATATTGAATGCCTGG + Intergenic
985975876 5:3418741-3418763 TATGTTGCAAATTTAAAGAGAGG - Intergenic
986110927 5:4716144-4716166 TATGATACAACTTTAACTCCAGG + Intergenic
989001512 5:36765471-36765493 TAGGATTCAAAATTGAAGCCGGG - Intergenic
990386197 5:55265616-55265638 TATGAACCAAATTTAAAGTGTGG + Intronic
990806721 5:59671510-59671532 TATAATACAATTTTACAGCCAGG + Intronic
991060959 5:62375501-62375523 TAAGATCTAAATTTCAATCCTGG - Intronic
991596635 5:68313528-68313550 CATGGTCAACATTTAAAGCCTGG - Intergenic
993421441 5:87706266-87706288 TATGACCCAAAGTTAAAACTAGG + Intergenic
995057368 5:107775359-107775381 TCTGAACCAAATTTGAAGCCTGG - Intergenic
995862426 5:116655408-116655430 TATGAACCAATTTTAAACCTTGG - Intergenic
996168332 5:120255038-120255060 TATGATAAAAAAATAAAGCCTGG - Intergenic
998539221 5:142964281-142964303 TATGATCAAAACTGAAAGCGGGG - Intronic
1000003172 5:157159434-157159456 AATGTTCCAAACTTAAAGTCTGG - Intronic
1001489198 5:172143792-172143814 TACGATCCAATATCAAAGCCCGG + Intronic
1002016421 5:176326946-176326968 CAGAATCCAAATTTAAACCCAGG + Intronic
1006214419 6:32427810-32427832 TAAGATCAAAATTTAAAGTATGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1011452155 6:87504882-87504904 TATAATACAAATTTCAAGACTGG - Intronic
1012782720 6:103583284-103583306 TATAATAAAAATTAAAAGCCTGG + Intergenic
1013919132 6:115379722-115379744 AATGATTCAAATATAAATCCAGG - Intergenic
1014015107 6:116520793-116520815 TATGATAAAAATTTAAAAACTGG + Exonic
1021602250 7:22375938-22375960 TATGCTCCAAACTGAAAACCTGG - Intergenic
1021834457 7:24655362-24655384 TATAATCAAAATGTAAAGCAAGG + Intronic
1023212198 7:37818500-37818522 TATCAGCTACATTTAAAGCCCGG + Intronic
1023536029 7:41211971-41211993 AATGATCCAAATTGGAAGCATGG - Intergenic
1024259600 7:47563896-47563918 TATGATTAACATTTAAGGCCGGG + Intronic
1026395010 7:69942969-69942991 TATGGTCCCGATTTAAAGACTGG - Intronic
1027782353 7:82535319-82535341 TATAATAAAAATTTACAGCCTGG + Intergenic
1029901412 7:104044242-104044264 TGTGATTCAAATGTGAAGCCAGG + Intergenic
1031732787 7:125319369-125319391 TATTATCCAAAGATAAGGCCAGG + Intergenic
1031867810 7:127058503-127058525 TATGATCCTATTTTAGGGCCTGG - Intronic
1031906680 7:127467486-127467508 TATGACCTGAATTTGAAGCCAGG + Intergenic
1032323290 7:130903357-130903379 TAGGATACAAATTAAAAGCTTGG + Intergenic
1034036658 7:147830580-147830602 TTTGCTCCAAAGTTAAAGCAGGG - Intronic
1038511759 8:28144099-28144121 TATAATCCAAATTTCATGACTGG - Intronic
1042042545 8:64608436-64608458 GATGACCCAAATTAACAGCCTGG - Intronic
1042581827 8:70288082-70288104 TATGATCCTATTTTAAAGACGGG - Intronic
1043470859 8:80560990-80561012 TATGATCCAAATATGAACCCAGG + Intergenic
1043924650 8:86023394-86023416 TATGATGCAAATATAAAACAAGG + Intronic
1046214425 8:111125090-111125112 TTTGTTCAAAATTTAAAACCTGG - Intergenic
1051972457 9:22906633-22906655 TATGATCATTTTTTAAAGCCAGG - Intergenic
1052041930 9:23748711-23748733 CATGAACTAAATTTGAAGCCAGG + Intronic
1055240360 9:74177697-74177719 TATAATCAAAGTATAAAGCCAGG - Intergenic
1055318816 9:75061738-75061760 TATGCTTCAAATTTAATGCAGGG - Intronic
1056337893 9:85594321-85594343 TATCATCTAAATTTCAGGCCAGG + Intronic
1057592646 9:96385625-96385647 TATTACCCTAATTTAAGGCCTGG + Intergenic
1058226665 9:102372234-102372256 AATGATACAAAGTTAAAACCAGG + Intergenic
1058554872 9:106156376-106156398 TATGATTGAGATTTAAATCCAGG + Intergenic
1060566818 9:124600076-124600098 TCTGATGCAAAGTGAAAGCCCGG + Intronic
1061803838 9:133127459-133127481 TGTGATCTATATTTAGAGCCTGG + Intronic
1062353639 9:136151832-136151854 TATGATTGAAATTTGAAGGCTGG + Intergenic
1186665559 X:11713384-11713406 TATGATTCAAATTCAAATTCAGG + Intergenic
1186748026 X:12590371-12590393 TATCATGCAAATTTAAAGCTTGG + Intronic
1186836794 X:13446381-13446403 TAAGATCCTATTTTACAGCCAGG - Intergenic
1188073813 X:25750387-25750409 TATGTTCCAAAGTTAAAGCCAGG + Intergenic
1189569817 X:42284668-42284690 TACAATCCAAATTAAAATCCTGG + Intergenic
1189991775 X:46602583-46602605 GATGATCCTAATTCACAGCCAGG + Intronic
1194806362 X:98333299-98333321 TATGAGCCTAATTCAATGCCAGG + Intergenic
1195329896 X:103788318-103788340 TAGAATCCAACTTTACAGCCAGG + Intronic
1198086687 X:133288925-133288947 TATGATCCAAGTTTTGTGCCAGG - Intergenic
1199502552 X:148523976-148523998 TATGATTCTCATTCAAAGCCTGG + Intronic
1201856277 Y:18547791-18547813 TATAATCCAAATTTCAAGCGTGG + Exonic
1201877044 Y:18772593-18772615 TATAATCCAAATTTCAAGCGTGG - Exonic
1202094246 Y:21228438-21228460 TGTGATACAAAGTTAAAACCAGG + Intergenic
1202171420 Y:22048669-22048691 TATAATCCAAATTTCAAACGTGG - Intergenic
1202219942 Y:22537703-22537725 TATAATCCAAATTTCAAACGTGG + Intergenic
1202323174 Y:23657963-23657985 TATAATCCAAATTTCAAACGTGG - Intergenic
1202547598 Y:26012091-26012113 TATAATCCAAATTTCAAACGTGG + Intergenic