ID: 962562129

View in Genome Browser
Species Human (GRCh38)
Location 3:136617441-136617463
Sequence TGGACTTATACCCATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962562126_962562129 -8 Left 962562126 3:136617426-136617448 CCTTCACCTGGCCTATGGACTTA 0: 1
1: 2
2: 6
3: 4
4: 128
Right 962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 108
962562124_962562129 -3 Left 962562124 3:136617421-136617443 CCAGGCCTTCACCTGGCCTATGG 0: 1
1: 0
2: 1
3: 24
4: 241
Right 962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 108
962562122_962562129 12 Left 962562122 3:136617406-136617428 CCATATATTTTATATCCAGGCCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962562129 Original CRISPR TGGACTTATACCCATGTGCC TGG Intronic
901774555 1:11551207-11551229 TGTTCTTCTACCCATGTGCTGGG - Intergenic
904080554 1:27869792-27869814 TGGGCATGTCCCCATGTGCCTGG + Intergenic
904361104 1:29972358-29972380 TGGATTTATGCCAATGTGCCTGG + Intergenic
906650112 1:47507099-47507121 TGGACGTGTGCACATGTGCCTGG - Intergenic
907071842 1:51542602-51542624 TGGAATAATTACCATGTGCCAGG + Intergenic
907487990 1:54790235-54790257 TGGACTTGCACCACTGTGCCTGG - Intronic
916119543 1:161515781-161515803 TGAAATTTTAGCCATGTGCCAGG - Intronic
916129308 1:161597438-161597460 TGAAATTTTAGCCATGTGCCAGG - Intronic
919530245 1:198708854-198708876 TTGACTTAAAGCCATCTGCCAGG + Intronic
922726984 1:227927249-227927271 AGGACACACACCCATGTGCCAGG + Intronic
923882648 1:238120364-238120386 TGGACTCATTCACAAGTGCCTGG + Intergenic
924929923 1:248721609-248721631 TGGACTTACACCCGTGTGCTTGG - Intronic
1062888760 10:1039252-1039274 TGGACTTGTCCCCAGGTGCCAGG + Intergenic
1064265637 10:13823087-13823109 GGGACTGATACCCATGTGGGAGG + Intronic
1065693246 10:28356678-28356700 TTGACTTCTGCCTATGTGCCAGG + Intergenic
1067058609 10:43066394-43066416 TGGACTTATGCCCCTGGCCCTGG - Intergenic
1067794179 10:49308679-49308701 TGGAGATATAGCCATGTGCAGGG - Intronic
1068243440 10:54335676-54335698 TGGACTCAGTTCCATGTGCCTGG - Intronic
1068591093 10:58853857-58853879 TTGACCTAGACTCATGTGCCAGG - Intergenic
1069427127 10:68298324-68298346 TGGGATTATAGGCATGTGCCTGG - Intronic
1069975891 10:72212711-72212733 TGGGATTACAGCCATGTGCCAGG - Intronic
1070530572 10:77333259-77333281 TGGACTTACAGGCATGTGCCAGG - Intronic
1071610178 10:87024741-87024763 TGGATTTATACCCATTTGGATGG + Intergenic
1073048328 10:100653108-100653130 TGGATTTGGACACATGTGCCCGG + Intergenic
1073654887 10:105403012-105403034 TGGACTTAGTTCCATGTGGCTGG - Intergenic
1074823659 10:117199617-117199639 GGGACTTAAACCCATGTATCTGG + Intronic
1080302970 11:30804877-30804899 TGATCTTAAACCCATTTGCCTGG + Intergenic
1080925279 11:36749778-36749800 TGAAGCTATACCCCTGTGCCTGG - Intergenic
1081943620 11:46967668-46967690 TGGAGTTCTTCCTATGTGCCGGG - Intronic
1084577777 11:70001065-70001087 TGGCCTTTTACCCTTGTGCAGGG - Intergenic
1086342335 11:85858744-85858766 TGGACTTATACCTGTGTGCTTGG + Intronic
1091224334 11:133948720-133948742 GGGAGTTATTCCCAGGTGCCAGG + Intronic
1096791905 12:54050656-54050678 TGGTATTTTACCCATGTGACAGG + Intronic
1105958128 13:25302975-25302997 TGGACAGATTCCCATGTGCAAGG + Intronic
1106021028 13:25915564-25915586 AGGACTTCTCCCCCTGTGCCTGG - Intronic
1113936529 13:113997889-113997911 GAGACCTATACACATGTGCCGGG - Intronic
1114879619 14:26768374-26768396 TGGGATTACAGCCATGTGCCAGG - Intergenic
1119041450 14:71278289-71278311 TGGAATCATATCCAAGTGCCAGG - Intergenic
1120480380 14:85041823-85041845 TGGACCCAGACCCATGTGCATGG + Intergenic
1121010843 14:90519246-90519268 TGGCCCTGTACCCCTGTGCCAGG + Intergenic
1122154188 14:99740542-99740564 TGGATTTATGGCCCTGTGCCTGG + Intronic
1126000390 15:44204400-44204422 TGGACTCATATCCAAGTGTCTGG + Intergenic
1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG + Intergenic
1129852840 15:78804423-78804445 TGGATTTATACCCAGCTCCCAGG + Intronic
1129901660 15:79156251-79156273 TGGACTGCTACCTCTGTGCCAGG + Intergenic
1132049290 15:98593502-98593524 TGGAATTACAGGCATGTGCCAGG - Intergenic
1134479817 16:14609057-14609079 TGGATTTAGAGCCATGTACCGGG - Exonic
1134665817 16:16017875-16017897 TGTACTTATTCCCCTCTGCCTGG - Intronic
1135974760 16:27100899-27100921 TTGAGTTCTTCCCATGTGCCAGG - Intergenic
1138081512 16:54095180-54095202 TAGACTTATGCCACTGTGCCTGG + Intronic
1138306108 16:55976670-55976692 TTGACTGATAGCCATATGCCAGG - Intergenic
1139310705 16:66025707-66025729 TGGACTTAGCCCTAGGTGCCTGG - Intergenic
1140592751 16:76372686-76372708 TGGACTTAGTTCCATGTGGCTGG - Intronic
1141525868 16:84611238-84611260 TGGACTCATTCCCAGATGCCTGG + Intronic
1143269572 17:5665753-5665775 TGGACTTATGCACCTTTGCCAGG + Intergenic
1143366747 17:6413699-6413721 TGGCCTTCAACCCATGTCCCAGG + Intronic
1144511795 17:15883397-15883419 TGGAGTTAGACCCATATTCCTGG - Intergenic
1150455708 17:65305020-65305042 TCAGCTTAGACCCATGTGCCTGG - Intergenic
1155039775 18:22055304-22055326 TGGAATTATAAGCATGAGCCTGG - Intergenic
1157604036 18:48914617-48914639 TGGACATGTGCCCAGGTGCCAGG - Intergenic
1160091228 18:75828520-75828542 TGGAATTACACCCAACTGCCTGG - Intergenic
935545275 2:104394614-104394636 TGGATTTATACCCGTGTGCTTGG - Intergenic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
936644184 2:114349732-114349754 TGGAATTATGCCCATGTCCTAGG - Intergenic
939189539 2:138901057-138901079 TGGACTTATACCTGTGTGCTTGG - Intergenic
941458604 2:165739137-165739159 TGGAATTATAGGCATGAGCCCGG + Intergenic
942654702 2:178203319-178203341 TAGGCTTATACCACTGTGCCTGG + Intronic
942772347 2:179537165-179537187 TGGAATTACAGGCATGTGCCCGG - Intronic
943056280 2:182984838-182984860 AGGACTCATTACCATGTGCCAGG - Intronic
1171431813 20:25087719-25087741 TGGCCTTGTTCCCAGGTGCCTGG + Intergenic
1172356026 20:34280658-34280680 TGGACTTATACCTGTGTGCTTGG - Exonic
1172438988 20:34952175-34952197 TGGACTTGAACCCATGTCTCTGG + Intronic
1174046673 20:47738749-47738771 TGGACTTAGTTCCATGTGGCTGG - Intronic
1174151042 20:48486504-48486526 TGGACATATACACAGGTCCCAGG - Intergenic
1179167533 21:38946573-38946595 GGGACTTAAACCCAAGTTCCAGG - Intergenic
1181308818 22:21932705-21932727 GGGAGTTATAGCCATGTGCAGGG - Intronic
1182416032 22:30222053-30222075 TGTCCTTATACCCATTTGACAGG + Intergenic
1183413898 22:37671832-37671854 TGGCCTTATTCCCATCTTCCAGG + Intergenic
1183870423 22:40737547-40737569 TGGGATTATAGGCATGTGCCTGG + Intergenic
950975538 3:17238884-17238906 TGACCTAGTACCCATGTGCCAGG - Intronic
962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG + Intronic
963063293 3:141242126-141242148 TGGACTTATACCAATGCTTCTGG + Intronic
964542559 3:157795873-157795895 TGTGCATATACACATGTGCCTGG + Intergenic
966278662 3:178205516-178205538 TGGACTTAGTTCCATGTGGCTGG + Intergenic
968481201 4:833815-833837 GGGAGTCAAACCCATGTGCCTGG + Intergenic
972814211 4:42626192-42626214 TGGATTTCTAGCCATGTTCCTGG - Intronic
975756638 4:77578083-77578105 AGGACTTTTACCCTTTTGCCAGG - Intronic
978843639 4:113245937-113245959 TGGAATTACAGGCATGTGCCTGG + Intronic
985706180 5:1402725-1402747 TGGACGCACACCCATGGGCCCGG + Intronic
986172536 5:5326130-5326152 AGGGCATATCCCCATGTGCCAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
995948652 5:117682337-117682359 TTGAATAATAACCATGTGCCAGG - Intergenic
997350303 5:133226322-133226344 TGGCCTTTCACCCATGTTCCAGG - Intronic
998831685 5:146166430-146166452 TAGGCTTATACCTCTGTGCCTGG - Intronic
1000608239 5:163347454-163347476 TGGGCTTAAATTCATGTGCCTGG + Intergenic
1002758620 6:184392-184414 TTGACTCCTACCCATGTGACAGG - Intergenic
1003284367 6:4721995-4722017 TGGGATTATAGGCATGTGCCTGG + Intronic
1008050626 6:46897215-46897237 TGAATTTCTACCCATGTGACTGG - Intronic
1008431115 6:51418272-51418294 TGGGCTTGTAACCATTTGCCTGG - Intergenic
1011812866 6:91153248-91153270 GGGAATTCTACCCATGTGCAAGG - Intergenic
1020483348 7:8690114-8690136 TAGACTCATACCCCTGTGGCAGG + Intronic
1023695923 7:42846099-42846121 TGGTCATGTGCCCATGTGCCAGG + Intergenic
1024154868 7:46611174-46611196 TTGACTAACACACATGTGCCAGG - Intergenic
1024342643 7:48282886-48282908 TGTTCTAATCCCCATGTGCCAGG - Intronic
1031625059 7:123983261-123983283 TGGACTTAGAGCCATGCTCCTGG + Intergenic
1031984161 7:128152004-128152026 TGGACCTAAACACATGTGCACGG - Intergenic
1033605807 7:142927934-142927956 TGGACTTTCCCCCATGTCCCAGG + Intronic
1040388313 8:46929364-46929386 TGGACTGAAGCCCATGTGCTTGG + Intergenic
1046699031 8:117378788-117378810 TTGACTGATTACCATGTGCCAGG - Intergenic
1055185119 9:73442080-73442102 GGGACTCATACCCCTGTGCTGGG - Intergenic
1055818252 9:80232316-80232338 TGGACTTCTGGCCATCTGCCTGG + Intergenic
1056114689 9:83430396-83430418 TGTACTTATACACATGTACAGGG - Intronic
1056816685 9:89806818-89806840 TGGTCATACATCCATGTGCCAGG + Intergenic
1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG + Intergenic
1189128656 X:38475542-38475564 TTGAATTATAGCCATGTTCCTGG - Intronic
1193606338 X:83572110-83572132 TTGAGTTCTAACCATGTGCCAGG - Intergenic
1199313122 X:146344767-146344789 TCTACATATATCCATGTGCCAGG - Intergenic
1200784561 Y:7248952-7248974 TGGTCTTTTACCCATGTGGTTGG - Intergenic