ID: 962562794

View in Genome Browser
Species Human (GRCh38)
Location 3:136624796-136624818
Sequence TGGCATAACCAAAGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962562789_962562794 -3 Left 962562789 3:136624776-136624798 CCAATTTCAAATGACCAAAGTGG 0: 1
1: 0
2: 3
3: 26
4: 292
Right 962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
962562788_962562794 3 Left 962562788 3:136624770-136624792 CCATAGCCAATTTCAAATGACCA 0: 1
1: 0
2: 3
3: 65
4: 296
Right 962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
962562787_962562794 7 Left 962562787 3:136624766-136624788 CCTACCATAGCCAATTTCAAATG 0: 1
1: 2
2: 6
3: 52
4: 293
Right 962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962562794 Original CRISPR TGGCATAACCAAAGTGAGGT GGG Intronic
900907058 1:5566807-5566829 TGCCATAAATAAAGTGAGCTTGG + Intergenic
906309171 1:44740721-44740743 TAGAATATCCACAGTGAGGTGGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907148954 1:52264155-52264177 TAAAATAACCAGAGTGAGGTGGG + Intronic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
922931222 1:229391096-229391118 TGGCTTAAGCAAAGAGGGGTGGG - Intergenic
1064218043 10:13416993-13417015 TGGCATAACACCCGTGAGGTGGG - Intergenic
1072759179 10:98041798-98041820 TTGCATTAACCAAGTGAGGTTGG + Intergenic
1076342853 10:129761434-129761456 TGGCATCACCAAAGGCTGGTGGG - Intronic
1076349533 10:129806479-129806501 TGACATATCCAAAGTGAAGAGGG - Intergenic
1077744872 11:4891328-4891350 TGGCAAAAACAAAGTGAGAGGGG + Intronic
1078555588 11:12323271-12323293 TTGTATAAACAAAGTGAGGTTGG + Intronic
1080881188 11:36322470-36322492 TGGTATGACCAAAGTACGGTAGG - Intronic
1083351526 11:62032817-62032839 TGGCCTATCCAAAGTTAGGCAGG + Intergenic
1084748370 11:71188022-71188044 TGGTATCACGAAACTGAGGTAGG + Intronic
1088397483 11:109384494-109384516 TGGCATGAGCAAAGCTAGGTAGG - Intergenic
1088732142 11:112693101-112693123 GGGCACAACAGAAGTGAGGTGGG + Intergenic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1093115597 12:15206973-15206995 TGCCATAACAAAGGTGAGCTGGG - Intronic
1099149863 12:79096841-79096863 TGCCATATTCACAGTGAGGTGGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1109135744 13:58648389-58648411 TGGCATAAACAAAGTTAAATGGG + Intergenic
1110426107 13:75369194-75369216 TTTCAAAACCAAAGTCAGGTGGG + Intronic
1110895541 13:80746895-80746917 TGGCACAACCAAAGTCTGATGGG + Intergenic
1111098464 13:83546668-83546690 TGGCATATCCAAAATGATCTTGG + Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1113705693 13:112431709-112431731 TGGGAGAACTAAAGAGAGGTGGG + Intronic
1116704236 14:48276277-48276299 TGGGATAACTAAAGAGAGGAGGG - Intergenic
1116966211 14:51017786-51017808 TGGCATTGCCAAAGTGAGTGGGG + Intronic
1117409488 14:55438421-55438443 TGGCCTAAGAAAAGTGAGATGGG + Intronic
1117511157 14:56452910-56452932 TGGAATGAGCAAAGTGGGGTTGG - Intergenic
1118710093 14:68511777-68511799 GGGCATATCCAAAGTGATCTAGG + Intronic
1118996774 14:70843678-70843700 TGGCTTACCCAAAGTGAGCCAGG - Intergenic
1126445300 15:48736483-48736505 TGGCAGAACAAAAGGGAGGCAGG - Intronic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1134417563 16:14057743-14057765 TAGCATATCCAGAGTGTGGTAGG - Intergenic
1136930083 16:34410664-34410686 TGGCATAACCCCTTTGAGGTGGG + Intergenic
1136974491 16:35001141-35001163 TGGCATAACCCCTTTGAGGTGGG - Intergenic
1138818047 16:60225513-60225535 TGGCATAACCAAAGTCAACAGGG - Intergenic
1141213628 16:82004169-82004191 TGGTATAAACAAAGTGTGGTGGG + Intronic
1143324393 17:6089076-6089098 TGACATAACAAAGGTGAGGCCGG - Intronic
1144191897 17:12854052-12854074 TGGCAGAACAAAAGGCAGGTGGG + Intronic
1147597406 17:41725780-41725802 TGGCAGAACCAGAGGCAGGTGGG + Intronic
1148946889 17:51270519-51270541 TGGCATAATCCAATTGAAGTTGG + Intronic
1149282313 17:55121334-55121356 TGATGGAACCAAAGTGAGGTTGG + Intronic
1151901075 17:77015623-77015645 TGACTTAAACAAAGTGAGGGAGG + Intergenic
1155870942 18:31027304-31027326 TGGAATGCCAAAAGTGAGGTAGG + Intronic
1158267652 18:55677785-55677807 TTGCATAAGCCAAGTGAGTTGGG - Intergenic
1160314479 18:77828776-77828798 TGGCATAACCCAATTCACGTAGG - Intergenic
1162098076 19:8322651-8322673 TGGCCCCACCAAGGTGAGGTGGG - Exonic
1163088466 19:15000966-15000988 TGGGATAACCCAAATTAGGTGGG - Intronic
925244300 2:2366534-2366556 TGGAATGACCAAAGTTAGGGTGG - Intergenic
928104354 2:28458259-28458281 TGTCCTAAGCAAACTGAGGTAGG + Intronic
929574899 2:43045311-43045333 TGGATTAACCAAAGTGAGTTGGG - Intergenic
931372528 2:61677049-61677071 TGGTTTAAAAAAAGTGAGGTAGG - Intergenic
933641940 2:84771665-84771687 TGGCATATTCAAAGTGCTGTGGG + Intronic
935653294 2:105399653-105399675 CGGGAAAACCAAAGTGAGCTGGG + Intronic
937311023 2:120903547-120903569 TGGCATAACCACAGGCAGGTTGG + Intronic
938196683 2:129334799-129334821 GGGCATCAGCAAAGTGAGGCTGG + Intergenic
938710792 2:133974730-133974752 AGGCATCACCATAGTGAGGCAGG - Intergenic
942066643 2:172277710-172277732 TGGCATATCCAGAGGGAGATGGG + Intergenic
946569063 2:221001302-221001324 GGGCATAATCAAAGTTAGGAGGG - Intergenic
1169318460 20:4611942-4611964 TGACATAGCCAAATGGAGGTGGG + Intergenic
1169600035 20:7247967-7247989 TGGCAAAGGCAAAGTGAGGGCGG + Intergenic
1175771741 20:61628404-61628426 TGGCAAACCCAAAGTGCAGTGGG - Intronic
1176728467 21:10465489-10465511 GGGCAGAAGCCAAGTGAGGTAGG - Intergenic
1177706545 21:24713721-24713743 TAGCATAAACTTAGTGAGGTGGG + Intergenic
1183077744 22:35437380-35437402 TGGCATAACAAGAGTTGGGTGGG + Intergenic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
956263511 3:67371743-67371765 TGGCATAACCTTAGTGAATTTGG + Intronic
956349393 3:68318011-68318033 TGGCAGCACCACAGTGAGTTTGG - Intronic
957348835 3:78996903-78996925 TGGCAGAACAACATTGAGGTAGG - Intronic
959252045 3:103961433-103961455 TGTTATTACCTAAGTGAGGTAGG + Intergenic
962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG + Intronic
965247771 3:166296806-166296828 TGGCTGAAAAAAAGTGAGGTAGG + Intergenic
967135386 3:186508741-186508763 TGGCCTAAACAGAGTGTGGTGGG + Intergenic
970113778 4:12669846-12669868 TGCCATAACCACAGTGCAGTTGG + Intergenic
975721909 4:77256321-77256343 TGGCATAGTCCATGTGAGGTGGG + Intronic
977342827 4:95781067-95781089 TGGCATCAACAAAGTAGGGTAGG + Intergenic
978846000 4:113273575-113273597 TGTCATAATAAAAGTGAGGAAGG - Intronic
984482670 4:180325973-180325995 TGGCAAAACCTAAGTCAGATTGG - Intergenic
987133968 5:14883758-14883780 TGGATTCACCAAAGAGAGGTGGG - Intergenic
988903062 5:35754717-35754739 TGCCCTAACAAAAGGGAGGTGGG + Intronic
994039332 5:95240402-95240424 TGGCAGAAACAAAGTGAAGGTGG + Intronic
995781434 5:115780224-115780246 TGGCTTAACTAAAGTGAAGGTGG - Intergenic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1007039012 6:38704203-38704225 TCACCTAACCAAAATGAGGTTGG + Intergenic
1007222297 6:40288511-40288533 TGCCATAAGCAAATTGTGGTTGG + Intergenic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1011420189 6:87163763-87163785 TTGGATAACCAAAGAGAAGTGGG + Intronic
1011857533 6:91713261-91713283 TGGCATAAAGAATATGAGGTAGG - Intergenic
1012139310 6:95602382-95602404 TGCCACAACAAAATTGAGGTAGG - Intronic
1015465850 6:133547884-133547906 TGGCATAAACAAAGATAGGAAGG - Intergenic
1016337064 6:143018434-143018456 TGGCATAAACAGAGAGAGGGAGG + Intergenic
1017746781 6:157454136-157454158 TGAGATAACCAAAGGGATGTAGG - Intronic
1020718313 7:11707496-11707518 TGGCAAAACAAAAGTCAGCTGGG - Intronic
1023487540 7:40702955-40702977 TGGAATAACAAAGGTGAGGCAGG - Intronic
1024438796 7:49390527-49390549 TGGCTTAAACAAAGTAAGTTGGG + Intergenic
1028711264 7:93911500-93911522 TAGCTTATCCAAAGTGAGTTGGG - Intergenic
1028711619 7:93915696-93915718 TAGCTTATCCAAAGTGAGTTGGG - Intergenic
1031399282 7:121312665-121312687 TGGCCTAATCAACATGAGGTTGG - Intergenic
1034601623 7:152262471-152262493 GGGCAGAAGCCAAGTGAGGTAGG + Intronic
1036038288 8:5044289-5044311 TGGCATAACCACAGACATGTAGG + Intergenic
1037044223 8:14277040-14277062 TAGCACAAACAAAGTGAGGAAGG - Intronic
1043234613 8:77847278-77847300 GGCAATAACCAAAGTGAGTTTGG + Intergenic
1043843217 8:85133808-85133830 TGGCATAAACAGAGGGGGGTAGG - Intronic
1045515053 8:102852123-102852145 TGGCATGACCAAAGGTAGGATGG - Intronic
1046877451 8:119271475-119271497 TGACATAGCCAAATGGAGGTAGG - Intergenic
1047180094 8:122579211-122579233 TGCCAGAACCAAAGTGCGGTAGG - Intergenic
1058395752 9:104552040-104552062 AGGGATAACCAAAGTGGGATAGG + Intergenic
1058426057 9:104876132-104876154 TGGCATGACCCAAGTGGTGTGGG - Intronic
1059290794 9:113221840-113221862 TGGCATAGCCAGAGTGACCTTGG + Intronic
1060010671 9:120040612-120040634 AGGCATAAGGAAAGTGAGGCTGG - Intergenic
1187840157 X:23478666-23478688 TGACATAAGCAAAGTGTTGTGGG + Intergenic
1188483202 X:30654560-30654582 TGGCATAACAAAAATTAGCTGGG + Intronic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1194510490 X:94787949-94787971 TAGCCTAACCAAATTTAGGTAGG + Intergenic
1195900810 X:109795365-109795387 TGGCACAACCAAATCCAGGTTGG + Intergenic
1196064929 X:111453711-111453733 TGGCATAACTAAGGTGAGAGTGG + Intergenic
1197176793 X:123494730-123494752 TAGCATAATCCAAGTGAGGGGGG - Intergenic
1201860915 Y:18596371-18596393 TGGCTTCAGCAAAGGGAGGTAGG + Intergenic
1201872408 Y:18724009-18724031 TGGCTTCAGCAAAGGGAGGTAGG - Intergenic
1202043693 Y:20714479-20714501 TGGCATAGTGAAAGTGAGATTGG + Intergenic