ID: 962568391

View in Genome Browser
Species Human (GRCh38)
Location 3:136687697-136687719
Sequence TTGTCTTTCTAGAAAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962568388_962568391 13 Left 962568388 3:136687661-136687683 CCCTTTGGCAAGAGACTGGGAAA 0: 1
1: 0
2: 1
3: 23
4: 234
Right 962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG 0: 1
1: 0
2: 4
3: 54
4: 511
962568387_962568391 14 Left 962568387 3:136687660-136687682 CCCCTTTGGCAAGAGACTGGGAA 0: 1
1: 0
2: 0
3: 20
4: 169
Right 962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG 0: 1
1: 0
2: 4
3: 54
4: 511
962568389_962568391 12 Left 962568389 3:136687662-136687684 CCTTTGGCAAGAGACTGGGAAAC 0: 1
1: 0
2: 1
3: 16
4: 179
Right 962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG 0: 1
1: 0
2: 4
3: 54
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962568391 Original CRISPR TTGTCTTTCTAGAAAAATGA AGG Intronic
901739246 1:11331440-11331462 TTTTCTTTTTAAATAAATGAGGG + Intergenic
902179929 1:14680135-14680157 TTATCTTTTTAAAAAAATTACGG + Intronic
902706241 1:18207161-18207183 TTGTCTTTGAAGAAAAATGCAGG - Intronic
903022043 1:20401449-20401471 TTCCCTTTCTGGAAAAAGGAGGG - Intergenic
903680554 1:25093589-25093611 TTGTATTTTTAGTAAAAAGAGGG - Intergenic
903905860 1:26686038-26686060 TGGGCTTTCTTGGAAAATGAGGG + Intergenic
904845677 1:33412894-33412916 TTGTCTTTATAGGAAACTCAGGG + Intronic
905360355 1:37415088-37415110 TTGTGTTTCTAATGAAATGACGG + Intergenic
906884797 1:49632631-49632653 TGGTTTTACTAGCAAAATGAAGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907538751 1:55192171-55192193 TTGTCTCTTTAAAAAAATAAGGG - Intronic
908122016 1:60994675-60994697 TTCTCCTCCTAGAAAAATGAGGG + Intronic
908718466 1:67096760-67096782 ATGTGTATCTAGAAAAATGCTGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
909556118 1:76956386-76956408 TTGTGACTATAGAAAAATGAGGG - Intronic
909888661 1:80974601-80974623 TTTTTTTTCTAGAGAAAGGAGGG + Intergenic
910111685 1:83690224-83690246 TTTTTTTTCTAAAAAAATGTGGG + Intergenic
911364778 1:96924662-96924684 TTTTCTTACTGGTAAAATGAAGG - Intergenic
911412951 1:97533748-97533770 TTCTCCTTCTAGAAATATAAGGG - Intronic
911865220 1:103010139-103010161 TTATCTTTATAGACAAATGGAGG - Intronic
912355330 1:109050113-109050135 TTATATTTCTGGAAAAAAGAAGG + Intergenic
912398095 1:109364548-109364570 ATGTCAATCTAAAAAAATGAGGG + Intronic
913426012 1:118730520-118730542 TTGTATTTTTAGAAAAAACAGGG - Intergenic
913502136 1:119481087-119481109 TTTCCTTTCCTGAAAAATGAAGG + Intergenic
916444038 1:164855473-164855495 GTGACTTTCTAGAAAAAAAATGG - Intronic
916712031 1:167420002-167420024 TTATCTTTCCAAATAAATGAGGG - Exonic
917128085 1:171709174-171709196 TTATTTTTCTGGAATAATGAGGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918467780 1:184839015-184839037 GTTTCTTTCTAGAACAAAGAAGG + Intronic
919288412 1:195596348-195596370 TTGAGATTCTATAAAAATGAAGG - Intergenic
919985383 1:202670511-202670533 TTAAATGTCTAGAAAAATGAAGG + Intronic
920391711 1:205607627-205607649 TTGTTTTACTTGAAAAATAAAGG - Intronic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
921300955 1:213751119-213751141 TTGTCTGTGTAGAAAATTCATGG - Intergenic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922124581 1:222710377-222710399 TTGAATTTCTAGGAACATGAAGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923610610 1:235489390-235489412 TTGTCTGACTAGAAGAATAAAGG - Intronic
923812953 1:237340955-237340977 TTGTCTTTCTAGAAACAGAAAGG - Intronic
924015952 1:239723459-239723481 TTGTCTTTCAAAATAAATAATGG + Intronic
924024966 1:239822325-239822347 TTGTGTTTCTAAAACAAGGATGG + Intronic
1063678517 10:8163445-8163467 TTTTCTTTTTTGAAAAATAATGG + Intergenic
1063743887 10:8857580-8857602 TTTTTTTTTTAAAAAAATGAAGG + Intergenic
1063866199 10:10367933-10367955 TTTTTCTTCTAGTAAAATGAGGG + Intergenic
1064705699 10:18070217-18070239 TTGTCCTTCAAGAGAAATGACGG - Intergenic
1065086936 10:22188029-22188051 TTATTTTCCTAGAATAATGAGGG + Intergenic
1066124165 10:32323126-32323148 TTCTCTTTTTAAAAAAATTATGG - Intronic
1067137873 10:43627333-43627355 TTGGCTATTTTGAAAAATGACGG - Intergenic
1068421492 10:56800545-56800567 TTCTCTTTCTACAATAATTATGG + Intergenic
1068931583 10:62595839-62595861 TTTTCTTTCTAGGACAATGAAGG + Intronic
1069010420 10:63365725-63365747 TTTTCTTACTGGAAAAAAGAGGG + Intronic
1069282810 10:66676844-66676866 ATGACATTGTAGAAAAATGAAGG - Intronic
1069405690 10:68095634-68095656 TTGTCTTTAAAGAAAACTTAGGG - Intergenic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1071765441 10:88659309-88659331 TTGCCTTTCTTGATAAATAATGG - Intergenic
1072487146 10:95866354-95866376 ATATCTTTCCAGAAATATGAAGG - Exonic
1074836612 10:117302265-117302287 TTGTTTTTCTATTAAAGTGATGG - Intronic
1075833628 10:125433198-125433220 TTGTCTTTCAAGAAACTTGTAGG - Intergenic
1075981087 10:126740161-126740183 CTTTCTTTCTAGAAAGGTGATGG + Intergenic
1077934640 11:6770713-6770735 TTTTTATTCAAGAAAAATGAAGG - Intergenic
1078151786 11:8765863-8765885 TTGTATTTTTAGTAAAATTAGGG - Intronic
1078265140 11:9749788-9749810 TTTTGTCTGTAGAAAAATGATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078500062 11:11864180-11864202 TTGTATTACAAGAAAAATGTAGG + Intronic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079489188 11:20968621-20968643 TTATCTTTTTATCAAAATGAAGG - Intronic
1080942283 11:36932736-36932758 TTGCCTTTCCATAAAAAAGAAGG - Intergenic
1081161154 11:39750493-39750515 TTGTTTTTTTAAAAACATGAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082846771 11:57732636-57732658 TTGTTTTTCTGGAAAATTCATGG + Intronic
1082942264 11:58719243-58719265 TTTCCTTTCTCAAAAAATGAAGG - Intronic
1083132858 11:60642407-60642429 TGGACCTTCTAGAAAACTGAAGG - Intergenic
1083240380 11:61383688-61383710 TTTTCTTTCTAGTAAGATGAAGG + Intergenic
1083979920 11:66158780-66158802 TTGGAGTTCTAGAAAGATGAAGG + Intronic
1084093958 11:66897938-66897960 TTTTCTTTTCAGTAAAATGAGGG - Intronic
1084753231 11:71218022-71218044 TTGTATTTTTAGAAGAAAGAGGG + Intronic
1086601176 11:88636048-88636070 TTGTCTTTCTAGAAAAGCAGTGG - Intronic
1086959615 11:92969238-92969260 TTGCCTTTCTTGACAACTGATGG + Intergenic
1086996091 11:93358014-93358036 TTATCTTCATAGAAAAATAAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087271136 11:96113096-96113118 TAGTTTTTCTAGAAAATAGATGG + Intronic
1087483492 11:98732167-98732189 TTGTATTTTTAGTAAAATCAGGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088049493 11:105494211-105494233 TTGTTTTTCCAGAAAATAGAAGG + Intergenic
1088336200 11:108706858-108706880 TTATGTTTTTAGGAAAATGAGGG + Intronic
1089428327 11:118399767-118399789 TTATCTTCCCAGCAAAATGAAGG - Intronic
1089551736 11:119284623-119284645 TTTTCTTTCTCCAAAGATGAGGG + Intronic
1089563283 11:119356767-119356789 TTGTCTTTTTAAAAAATTTAGGG + Exonic
1089880273 11:121766642-121766664 TTAGCTTTCTAGAAAACTGGTGG + Intergenic
1090101934 11:123806571-123806593 TTGTTTTTCCTGTAAAATGACGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092600560 12:10058356-10058378 CTCTCTTTCTAGCAAAATGATGG - Intronic
1092646275 12:10576725-10576747 TTCTCTGTCTAGAAAGATAATGG + Intergenic
1093204507 12:16231293-16231315 TTCTCATTCTAGTTAAATGATGG + Intronic
1093636072 12:21470121-21470143 TTGTCTAACTACAAAAATAATGG + Exonic
1094243844 12:28263102-28263124 TTTTCTTTCAAGAAAAAGTATGG + Intronic
1095145838 12:38725205-38725227 ATTGCTTTATAGAAAAATGATGG + Intronic
1095329451 12:40940296-40940318 TTGTCTTTAGAGGAAAATGGAGG + Intronic
1095906446 12:47383027-47383049 GTGTTTGCCTAGAAAAATGATGG + Intergenic
1096343350 12:50822903-50822925 TTGTTTTACTATAAAAGTGAAGG + Intergenic
1096372484 12:51080733-51080755 TTTTCTTTTTAAAAAAATGGTGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097328116 12:58302231-58302253 TTTTTTTCCTAGAAAAATGGGGG + Intergenic
1097349868 12:58536834-58536856 TTCTTTTTCTAGAACAAAGAGGG - Intergenic
1097354112 12:58582476-58582498 TTTTCTTACTAGCAATATGAAGG + Intronic
1097541133 12:60945207-60945229 ATGTTTTGCTTGAAAAATGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098649286 12:72944007-72944029 TTTCGTTTCTAGAAAAATGGTGG + Intergenic
1098885092 12:75952950-75952972 TTGGCTTTCCAATAAAATGAAGG - Intergenic
1098912187 12:76220587-76220609 TTGTTTTTTTTGAAAAATAAAGG + Intergenic
1098943461 12:76563690-76563712 TTCTGTTTCTAGAAATATCAAGG + Intergenic
1099006354 12:77239050-77239072 TTTTCTTTGTAGACAAATAATGG - Intergenic
1099234424 12:80066221-80066243 TTGTCACTCTAGAAACATTAAGG - Intergenic
1099294457 12:80812854-80812876 TTGACTTGTTAGAAGAATGAAGG - Intronic
1099399817 12:82189534-82189556 AAGTCTTTCTTCAAAAATGAAGG + Intergenic
1100129585 12:91474925-91474947 TTCTCTTTCTCCAGAAATGATGG + Intergenic
1100306524 12:93354935-93354957 TTGTCTGTTTTTAAAAATGAGGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101230795 12:102738994-102739016 TTGTCTTTCTAGATAACATAAGG - Intergenic
1101276401 12:103206375-103206397 TTATCTTTGCAGAAAAATGAGGG + Intergenic
1101947852 12:109151500-109151522 TTGCTTTTCTGCAAAAATGAAGG + Intronic
1102202132 12:111064554-111064576 TCTTCTTTTTAGAAATATGATGG + Intronic
1103470032 12:121173016-121173038 TTGTTTTTCAAGAATAATTAAGG - Intronic
1104135056 12:125929891-125929913 TGGTCCTTCTTGAAAAATCACGG - Intergenic
1104402874 12:128491268-128491290 TTGTATTTCAAGAAAAATGGAGG - Intronic
1106068840 13:26386854-26386876 TTTTCTTTCTAGAAACAAAAAGG + Intronic
1106527808 13:30558646-30558668 ATGTCTTTTTGGAAAAAGGAAGG - Intronic
1106739749 13:32627593-32627615 TTGTTTTCCTGGGAAAATGAAGG + Intronic
1106761331 13:32871259-32871281 TTGTCTTTTTAAAAAATTAAGGG - Intergenic
1106922740 13:34580978-34581000 CTATTTTTCTAGAAACATGAAGG - Intergenic
1107074272 13:36304958-36304980 CTCCCTTTCTAGAAATATGAGGG + Intronic
1107358097 13:39589627-39589649 GTGTCTGTCTTTAAAAATGAAGG - Intronic
1108119935 13:47174025-47174047 TGTTCTATCTAAAAAAATGAGGG - Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1110793961 13:79615712-79615734 TCTTCTTCCAAGAAAAATGAGGG + Intergenic
1111127359 13:83929014-83929036 CTGTCTTTCTAAAATAATGATGG + Intergenic
1111460018 13:88526865-88526887 TTTTATTTCTAGAGAATTGATGG - Intergenic
1111632215 13:90856644-90856666 GTGTCTTTTTAAAAAAATAAGGG + Intergenic
1111855724 13:93634665-93634687 TTGAGTTTCTAGAAGCATGAAGG + Intronic
1111920519 13:94405401-94405423 TTGTCTTTCTCCAATAATTAAGG + Exonic
1112080422 13:95963622-95963644 TTGTATATCTAGAAAAACCAAGG + Intronic
1113049284 13:106190671-106190693 TTGTCTCTTTAGAACAGTGATGG - Intergenic
1113510456 13:110850469-110850491 TTTTCTTTCTTGAAGAAGGAGGG - Intergenic
1115088215 14:29542716-29542738 TTTTTTTAATAGAAAAATGAAGG - Intergenic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116665603 14:47770437-47770459 ATGTCTCACCAGAAAAATGATGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117356394 14:54927569-54927591 TGGTATTTCTAGCAAAATGGTGG - Intergenic
1117521771 14:56558220-56558242 TTTTCTTTTTTGAAAAAGGAAGG + Intronic
1117539351 14:56731556-56731578 TTCTCATTCTACACAAATGAGGG + Intergenic
1117861287 14:60095022-60095044 GTGTCAGTCGAGAAAAATGATGG + Intronic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1120018277 14:79498955-79498977 TTTTCTTTCTATAGAAATGGAGG + Intronic
1120600232 14:86495208-86495230 TTGTGGTTCTATAAAAATGAAGG + Intergenic
1120681151 14:87482078-87482100 TTGGATTTCTAGAAGAATAATGG - Intergenic
1120720385 14:87884110-87884132 TTTTTTTTCTAGAGACATGAAGG + Intronic
1121269095 14:92626042-92626064 TAGTCTTTCTAGAAATTTCATGG + Intronic
1123677838 15:22729407-22729429 TTCTTGTTCAAGAAAAATGATGG - Intergenic
1124330039 15:28803671-28803693 TTCTTGTTCAAGAAAAATGATGG - Intergenic
1124800945 15:32832399-32832421 TTGTCTGTGAAGAAAAATTAGGG - Intronic
1125858846 15:42978576-42978598 TTTTGTTTATATAAAAATGAAGG + Intronic
1125944547 15:43702461-43702483 TTTTCTTTCTTAAAAAATAATGG - Intergenic
1126509911 15:49458594-49458616 TTGTCTTTATAGAAATCAGAGGG + Intronic
1126930293 15:53640511-53640533 TTGTATTTTTAGAAAAAGAATGG - Intronic
1128407602 15:67358953-67358975 TTGTGTTTCATGAAAAATGTGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128647951 15:69390840-69390862 TTTTCTTTCAAGAAAACTCATGG + Intronic
1130241477 15:82197141-82197163 TTGTCATTTTAGAAAATTGAAGG + Intronic
1133925132 16:10186078-10186100 TTGTCTTTCTTGAAAAATACTGG + Intergenic
1133979181 16:10620867-10620889 TTCTCTTTCTTAAAAAATCAAGG + Intergenic
1137265045 16:46861892-46861914 GTGTCTTTCCAGAATTATGAAGG - Intergenic
1138709735 16:58957311-58957333 TTCTATTTCTGGAAATATGATGG - Intergenic
1139456992 16:67088297-67088319 TTCTCTTTTTAGGAAAAAGAAGG - Intronic
1139963564 16:70731960-70731982 TTGTTTTTTTAAAAAAATCATGG - Intronic
1140329048 16:74035237-74035259 TTGTGTTTCTAGAAGTATAATGG - Intergenic
1140379591 16:74474341-74474363 GTGTTGTTCTAGAGAAATGAGGG + Intronic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1142834125 17:2572198-2572220 TTTTCTTTCTAGAACATTTATGG - Intergenic
1143359072 17:6352770-6352792 TTGGCTTTCTTTGAAAATGAAGG - Intergenic
1144349397 17:14380272-14380294 TTGTCTTGGTAGAAATTTGAGGG + Intergenic
1145070159 17:19798518-19798540 TTCTGTTTTTAGAAGAATGATGG - Intronic
1147174182 17:38642481-38642503 TTGTATTTCCATATAAATGATGG - Intergenic
1150722771 17:67627607-67627629 TTTTCTTTCTAGAAAGATGCAGG + Intronic
1151080291 17:71321852-71321874 TTGTCTCTATAGAAAATTAAAGG + Intergenic
1152451010 17:80380130-80380152 TTATTTTTTGAGAAAAATGAAGG + Intronic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154937077 18:21071854-21071876 TTTTCTTTTTTGTAAAATGAGGG + Intronic
1154951790 18:21217354-21217376 CTATCTTTCTATAAAAATGAGGG + Intergenic
1155259245 18:24025508-24025530 TTGTGTTTCTACATAAATGGAGG + Intronic
1155359321 18:24984434-24984456 TTCTCTTTCTAGGAAATTAAAGG - Intergenic
1155569521 18:27176366-27176388 TTGTTTTTCTACACAAAGGATGG + Intronic
1155846744 18:30717371-30717393 TTGTCTTTCCTGAAAATTAATGG - Intergenic
1155882972 18:31172966-31172988 TTTTTTTTCTGGAAAAATGCTGG + Intergenic
1156165369 18:34413704-34413726 TTTATTTTCTATAAAAATGAAGG + Intergenic
1156300772 18:35834122-35834144 TAGTCTTTCTAGAAATTTCATGG - Intergenic
1156815826 18:41309947-41309969 TAGTCAGTCTTGAAAAATGATGG - Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1156994821 18:43452577-43452599 CTGTGTTTCTACAAAACTGAGGG - Intergenic
1157044760 18:44087975-44087997 TTTTCTTTCTTGCAAAAGGAAGG + Intergenic
1157482207 18:48062591-48062613 GTCTCCTTCTAGGAAAATGAGGG - Intronic
1157758208 18:50237523-50237545 TTCTCTTTCTAGAAAGAGTATGG - Intronic
1158239366 18:55359873-55359895 ATGTTTTTCTAGACACATGATGG + Intronic
1158611948 18:58948939-58948961 TGGTATATTTAGAAAAATGAAGG + Intronic
1158702012 18:59756753-59756775 TTTTCATTCTAGAAAAACAAGGG + Intergenic
1159016922 18:63108574-63108596 TTCTTATTCTAGAAAAATCAAGG - Intergenic
1159750785 18:72299948-72299970 ATTTCTGTCTAGAAAAATGCAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160484824 18:79280989-79281011 TTTTCTATTTAAAAAAATGAAGG - Intronic
1161275867 19:3416821-3416843 TTGTGTTTTTAAAAAAATGTAGG - Intronic
1164463500 19:28468268-28468290 TTGTCTTGCTATAAAGAAGAAGG - Intergenic
1164893522 19:31846801-31846823 ATGGCTTTCTATAACAATGATGG + Intergenic
1165412507 19:35670588-35670610 CTGCCTGTCTAGAAAAATGAAGG - Intronic
1165599518 19:37041843-37041865 ATTTCTTTCTGTAAAAATGAAGG + Intronic
1165725894 19:38112690-38112712 TTTTCTTTCTTTAAAAATGAAGG - Intronic
1167859357 19:52270430-52270452 TTCTATTTCTAGACAGATGAAGG + Intronic
925454726 2:4006495-4006517 TTGGCTTTCAACAAAATTGAAGG - Intergenic
925472850 2:4181761-4181783 ATGTTTTGGTAGAAAAATGATGG - Intergenic
925614202 2:5729808-5729830 TTGTCTAGCTAGCAAAAGGACGG - Intergenic
927542344 2:23924275-23924297 ATTTCTTTCTACAAAAATAAGGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928650834 2:33401986-33402008 TTGTCTTTGTAGGAAATTAAGGG + Intergenic
928721963 2:34131392-34131414 TTGTCTTTCCAGGAAAATAAAGG - Intergenic
929942921 2:46348427-46348449 TTGTCTTACTGGATAACTGAGGG + Intronic
930351860 2:50266576-50266598 TTTTCTTTCTAGAAGAACTAAGG + Intronic
930858229 2:56042031-56042053 TTATCTTTATTTAAAAATGAAGG + Intergenic
930913980 2:56665277-56665299 TTTTCTATCTAAACAAATGAAGG - Intergenic
931528826 2:63189476-63189498 TTGTCTCCATAGAAAAATGAGGG + Intronic
931595636 2:63939579-63939601 TTCTCTTTGTAGAAAATTCAGGG + Intronic
931620896 2:64208346-64208368 TTGTCTTTTAAGAAAAATTAAGG - Intergenic
931906756 2:66850798-66850820 TTTGGATTCTAGAAAAATGAGGG + Intergenic
931968085 2:67555740-67555762 TTCTCTTTCTGTAAAATTGAGGG + Intergenic
933260453 2:80126157-80126179 TTTTCTTTTCAGAAAAAAGAGGG - Intronic
933309991 2:80648615-80648637 TTCTATTTCTAGCAAAATCATGG - Exonic
933584593 2:84167000-84167022 TTTTCTTTCTACAACAATGTTGG - Intergenic
933690597 2:85176590-85176612 TTATTTTTCTAGGATAATGAAGG - Intronic
933711543 2:85329765-85329787 TTGTCTCTATAAAAAAATAAAGG + Intergenic
933819659 2:86099182-86099204 TTGTATTTTTACAAAAATTACGG - Intronic
934160246 2:89242948-89242970 TTGTGTTTAAAAAAAAATGAAGG + Intergenic
936465094 2:112740903-112740925 TTGTCTTTCTCCAAAAGAGAGGG - Exonic
936498080 2:113040030-113040052 TAGTCTTTCTTGAAGAATAAGGG + Intronic
937239837 2:120452968-120452990 TGGACCTTCTAGAAAAAGGAGGG - Intergenic
937295805 2:120809293-120809315 TTGTCATTCTAGACAATTCATGG - Intronic
937426645 2:121805530-121805552 TTTCCTTACTAGTAAAATGAAGG - Intergenic
937673748 2:124566207-124566229 TTGTCTTGCTATTAAATTGATGG - Intronic
938132259 2:128726700-128726722 TAGTTTTTTTAGAAAAATCATGG - Intergenic
938663060 2:133506859-133506881 TTGTCTTTGTAGACAAATGATGG + Intronic
939240240 2:139548735-139548757 TTATCATTCTGGATAAATGAAGG + Intergenic
939364094 2:141210440-141210462 TTGTCTTTATGGAAGAAAGAAGG - Intronic
939668431 2:144979324-144979346 TTGGGTTTCTACAAGAATGAAGG + Intergenic
939773668 2:146357534-146357556 TTGGCTTTCTAGAGAAAGAAGGG - Intergenic
939906451 2:147921771-147921793 TTTTTTTTCTCAAAAAATGAGGG - Intronic
940137566 2:150456069-150456091 TTGATTTACTAGAAAAATCAAGG + Intergenic
940451395 2:153842639-153842661 TTGTGTTTTTTAAAAAATGAAGG - Intergenic
940456129 2:153902923-153902945 TTATTTTTTTAGATAAATGATGG - Intronic
940669325 2:156648760-156648782 TTTTCTTTCAAAAAAAATGAGGG - Intergenic
941610579 2:167656865-167656887 TTGTCTAACTAGAGAAATAATGG + Intergenic
941982545 2:171475111-171475133 CTGTCTTTTCAGAAAACTGAGGG + Intronic
942362161 2:175183456-175183478 TTGTATTTTTAGTAAAAAGACGG - Exonic
942538322 2:176988974-176988996 CCATCTTTCTAGAAAAATCAGGG - Intergenic
942968243 2:181923683-181923705 TTTTTTTTCTAGAAATGTGATGG + Intronic
943259214 2:185636833-185636855 TTGTCTGTCTAAACAACTGAGGG - Intergenic
943486392 2:188489594-188489616 TTGTTTAATTAGAAAAATGATGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
945111840 2:206367387-206367409 ATTGCTTTCTAGAAAAATAAAGG + Intergenic
945749031 2:213756933-213756955 TTGTCTTTATAGAGCAAAGAGGG + Intronic
945986583 2:216359302-216359324 TCTTCTTTGTAGAAAAATGGGGG - Intronic
946032025 2:216712952-216712974 TTGTCTAGCTTGAAAACTGATGG - Intergenic
946573250 2:221047304-221047326 TACTCTTTCTAGAAAAGGGAAGG - Intergenic
946608851 2:221436598-221436620 TTTTCTATGCAGAAAAATGATGG - Exonic
946910411 2:224455234-224455256 TTGACATTCTACAAAAATGAGGG - Intergenic
947509316 2:230736070-230736092 TTGACTCTCAAGAAAAATGGTGG + Intronic
1169435998 20:5590902-5590924 ATGTATTTCTACAAAAATGAAGG + Intronic
1169809299 20:9593127-9593149 TTTTCTTTGTAGAAAAAAAAAGG - Intronic
1169999960 20:11604920-11604942 TTGTGTTTCTTCAAAAATTATGG - Intergenic
1170480818 20:16763435-16763457 TTGTCTATTTTGAAAAATGTAGG - Intronic
1170650759 20:18238941-18238963 TGATCTTTGGAGAAAAATGATGG + Intergenic
1170662933 20:18360442-18360464 TTGTCTTTCTTGACAAGTGGAGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170695677 20:18656146-18656168 TTTTCTTTGTAGGAAAATGGAGG + Intronic
1170958690 20:21004973-21004995 TTGAATTTCTAGATAAATGCAGG - Intergenic
1171841693 20:30221470-30221492 GTATCTTTCAAGACAAATGAAGG - Intergenic
1172307776 20:33893764-33893786 GTGCCTCTCTGGAAAAATGAAGG + Intergenic
1172319298 20:33983720-33983742 TTTTCTCTCTAAGAAAATGAAGG + Intergenic
1173981261 20:47225839-47225861 TTGTTTTTCTAATAAAATCAGGG - Intronic
1174476709 20:50800965-50800987 TTGAGTTTCAAGAAAAATGTGGG + Intronic
1174625421 20:51910423-51910445 TTGCATTTCCAGAAATATGAGGG + Intergenic
1176979422 21:15363247-15363269 TTGAGTTCCTAGGAAAATGAAGG - Intergenic
1177109522 21:17007980-17008002 TTTTCTTTATAGAAATCTGATGG + Intergenic
1177252067 21:18605564-18605586 TTATCTTTCTAAAAAATTGACGG - Intergenic
1177350274 21:19930371-19930393 TTTTTTTTTTAGAAAAAAGAAGG + Intergenic
1177667729 21:24183030-24183052 TTCTCTGTATAGAAAAAGGATGG - Intergenic
1178129195 21:29550910-29550932 TTTTCTTACTTGTAAAATGAAGG - Intronic
1179053243 21:37907343-37907365 TTTTTTTTATAGAGAAATGATGG + Intronic
1179180385 21:39039700-39039722 TTCCCTGTCTAGAAAAATGAAGG + Intergenic
1179509660 21:41864140-41864162 TTGTCTTTGTAAAAAAATGCAGG - Intronic
1179562812 21:42227402-42227424 TTGTCTATATAGACAAATTATGG + Intronic
1181383722 22:22528082-22528104 TTGTCTTACAATAAGAATGATGG - Intergenic
1181830224 22:25554718-25554740 TTGTTTGTTTAGAAAAATTAAGG + Intergenic
1182391881 22:30004545-30004567 TTGTATCTCTAGAAAAAGGGGGG - Intronic
1183089309 22:35510530-35510552 TTTTCTTCCTGGGAAAATGAGGG + Intergenic
1183145475 22:35987238-35987260 TTGTGTTTGTAGAAAAACCAAGG + Intronic
950708668 3:14799918-14799940 TTGTCCTTTTAGTAAAATGAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952174353 3:30845367-30845389 TTTTCTTGCCAGAAAAATGAAGG + Intronic
952619954 3:35326237-35326259 TTGCCTTTCTAGTAAATTGTAGG - Intergenic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
955445476 3:59005648-59005670 TTGTCTGTCTAGAAATATAGTGG - Intronic
955591565 3:60541324-60541346 TTGTTTTTCAAGAATAAAGATGG + Intronic
956295780 3:67712401-67712423 TTGTCTGTGTAGGAAAAAGAGGG + Intergenic
956380905 3:68663539-68663561 TGCTCTTACTAGAAGAATGAGGG - Intergenic
956831987 3:73060014-73060036 TTGTCTTGAGTGAAAAATGAAGG + Intronic
957445562 3:80309985-80310007 TAGCCTTTCTAGAAAAGTGGAGG - Intergenic
957598812 3:82305606-82305628 TTTTCTCTCTACAAAAATGGAGG - Intergenic
958453204 3:94299090-94299112 TTATCTTTCCAGGAAAATGTAGG - Intergenic
958584622 3:96069856-96069878 TTGTATTTCTAGAACAGTTATGG + Intergenic
958628686 3:96659753-96659775 TTGTCTTTCCAGAAATGTAAGGG - Intergenic
958784984 3:98588107-98588129 TTGGCATTCTTGAAAAAGGAAGG - Intronic
958929075 3:100190030-100190052 TTACCTTTCAGGAAAAATGATGG + Exonic
960917729 3:122714194-122714216 TTTGCTTTCTAAACAAATGACGG + Intronic
960927467 3:122809179-122809201 TTTTCTTTCTAGAAAATTTAGGG + Intronic
961308400 3:125975945-125975967 TTGTCTCTCCAGAAAAGTGCAGG + Intronic
962048853 3:131791391-131791413 TTTTCTTTCCACAAAATTGAAGG - Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962858005 3:139367257-139367279 TTTTTTTTCTAGAAATAGGAAGG - Intronic
964946215 3:162227886-162227908 ATATCTTTTTAGAAAAATGCTGG + Intergenic
965388019 3:168069489-168069511 TTTTTTTCCTAGAAAAATGAAGG - Intronic
965614794 3:170583596-170583618 TTTTCTTTCTTGTAAAACGATGG + Intronic
966001213 3:174950950-174950972 TTGTCTCTTTAGATAAAGGATGG + Intronic
966488199 3:180495688-180495710 GTATCTTTTTAGAAATATGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967449357 3:189605654-189605676 TTCTATTTCTGGTAAAATGATGG + Intergenic
967485090 3:190020953-190020975 TTCTCTTTTTATAAAACTGAAGG - Intronic
967617514 3:191589674-191589696 ATCTATTTCTAGAGAAATGAGGG - Intergenic
969927561 4:10599392-10599414 TTGACCATCTAGAAAGATGATGG + Intronic
971035019 4:22683553-22683575 TTTCTTTTCTAGAATAATGAGGG - Intergenic
971176643 4:24288689-24288711 TTGTTCTTGTAGAAAAATGCTGG - Intergenic
971773900 4:30934869-30934891 TTCTCTTTCTGGAAATGTGATGG - Intronic
972081522 4:35157219-35157241 TAGTCTTTCCAGAAAAAAGTTGG + Intergenic
972475943 4:39449553-39449575 TTTTGTTGTTAGAAAAATGAAGG - Exonic
973073243 4:45891969-45891991 TTGTCTTTCTAGGAAGAAGTGGG + Intergenic
973169246 4:47118978-47119000 AAGTGTTACTAGAAAAATGAAGG - Intronic
974192777 4:58528848-58528870 TTTCCTTTCAAGAAAATTGAAGG - Intergenic
974694727 4:65351588-65351610 TTGTCTTTACAGAAAAACGATGG - Exonic
975551867 4:75621231-75621253 TTGTCATTTTAAAAAAATGCTGG - Intronic
975993230 4:80282786-80282808 TTTTTTTTCTAGAAAAATAATGG + Intronic
976261386 4:83148316-83148338 CTGGCTTACCAGAAAAATGAGGG - Intergenic
976279732 4:83315417-83315439 GTTTCCTCCTAGAAAAATGAGGG - Intronic
976728848 4:88242842-88242864 TTGTCTTTCTGGTATAAGGAGGG - Intergenic
977000602 4:91495027-91495049 TTTTCTCTCTAGCAAAATGTGGG + Intronic
977009072 4:91612901-91612923 TTTTTTTTCTAGGAAGATGAAGG - Intergenic
978735983 4:112085025-112085047 TTGTGTTTTAAGAAAACTGAGGG + Intergenic
978848051 4:113298211-113298233 TTTTTTTTCTAGAAAAACTAGGG - Intronic
979050693 4:115927873-115927895 TTTTCTCTGAAGAAAAATGAAGG + Intergenic
980232900 4:130066645-130066667 TTGTCTTTCCAGGAAAATAAAGG - Intergenic
980318330 4:131235059-131235081 TTCTTTATCTTGAAAAATGAGGG - Intergenic
980791767 4:137630094-137630116 CTGTTTTCCTAGAAAATTGAGGG - Intergenic
980947969 4:139341688-139341710 TTTGCTTTCCAGAAAAATGTGGG - Intronic
981316531 4:143345458-143345480 TTGTCTTCCTAAAAAAAGAAAGG - Intronic
981933403 4:150214093-150214115 TTGTCTTTGTAAGAAAAGGAAGG - Intronic
982755486 4:159213687-159213709 TTATCTTCCTAGATAGATGAGGG + Intronic
982758771 4:159255184-159255206 TTGTCTTTGTACAAACATCATGG - Intronic
982987625 4:162231342-162231364 GTGTCTTTCTAGATATATTATGG - Intergenic
983088503 4:163475824-163475846 TTATCTTTTTAGACAAATAAAGG + Intergenic
983300814 4:165923183-165923205 TTTTTTTTCTCTAAAAATGATGG + Intronic
983345095 4:166519267-166519289 TTGTCTAAATAGAAAAATAATGG - Intergenic
983461736 4:168032969-168032991 TTGAGTATTTAGAAAAATGAAGG - Intergenic
983867473 4:172786063-172786085 TTTTCTTCCTAGAAAATTCAAGG - Intronic
984159613 4:176235376-176235398 GTGTGTTTCTAGAAAAAAGTTGG - Intronic
984473492 4:180208077-180208099 TTGTCTTTCTAAAAAACTGAAGG - Intergenic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
986214957 5:5711428-5711450 TTTTCTGTCTCTAAAAATGATGG - Intergenic
986312186 5:6559348-6559370 TTGTCTTTCTGGCAACAAGAAGG - Intergenic
986668155 5:10120897-10120919 TTGTCTCTAAAGAATAATGAAGG + Intergenic
986694948 5:10343380-10343402 TTATCTTACTGGAAAAATTATGG + Intergenic
987535947 5:19187690-19187712 GTGTCTTTATAGAAGAATAATGG - Intergenic
987563413 5:19554062-19554084 TAATCTTTCTAAAAAAAAGAAGG + Intronic
987871345 5:23621957-23621979 TTTTCTTACTTGAAAAATGTGGG + Intergenic
988938126 5:36111125-36111147 TTGTCTTTTAAAATAAATGAAGG - Intronic
988981672 5:36575961-36575983 TTTTCTTATTAGAAAAATTAAGG + Intergenic
989312087 5:40031592-40031614 TTGGGTTTCTAGAACAATAATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990104742 5:52244947-52244969 TTTTCTTTTTAAGAAAATGAGGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990819716 5:59824446-59824468 TAGTCTTTCTATAAACATAAGGG - Intronic
991190775 5:63870599-63870621 TAGCCTTTCTAGAGACATGATGG - Intergenic
991458132 5:66826662-66826684 TGGTCCTTCTAGAAAAACTAGGG - Intronic
991547051 5:67794304-67794326 TTGTATTTCATGATAAATGAAGG - Intergenic
991558385 5:67922112-67922134 TTGTATTTCTAGTTACATGAAGG - Intergenic
992107839 5:73464777-73464799 TTGTTTTTCTCAAAAAAGGAAGG + Intergenic
992111693 5:73499735-73499757 TTGTATTACTGTAAAAATGAGGG + Intronic
993565608 5:89471214-89471236 TTGGCTTTCAAGAGAAATCATGG + Intergenic
993963129 5:94326437-94326459 TTCTTTTTCTTTAAAAATGATGG - Intronic
994849111 5:105031100-105031122 TTTTCCATCAAGAAAAATGAAGG - Intergenic
995233883 5:109803253-109803275 TTTTATTTCTTGAAAAATAAAGG + Intronic
995483988 5:112620495-112620517 TTTTTTTTGTAGAAAAATAATGG - Intergenic
995768415 5:115643836-115643858 TTTTCTTTCTAGAGAAAGAAGGG + Intergenic
996545620 5:124675674-124675696 GGGTATTTCTAAAAAAATGATGG - Intronic
996932187 5:128903369-128903391 TTTTATTTTTAGAAAAAAGATGG + Intronic
997133848 5:131303862-131303884 TTGTCTTCATAGCAATATGATGG + Intronic
997339653 5:133133028-133133050 TTGTATTTCTATAAAATTCAAGG - Intergenic
997575406 5:134972008-134972030 TTGTGTTTTTAGAAAAAAAAGGG + Intronic
998104616 5:139460514-139460536 TTTTCTTTCTAGATAAATGCAGG - Intronic
999085609 5:148886157-148886179 TGGGCTTCCTAGAAACATGATGG - Intergenic
1000403303 5:160856411-160856433 TTGTCTTTGTAGAAAATCCAAGG - Intergenic
1000666072 5:163998227-163998249 TAGTCTTTCTATAAATATCAAGG - Intergenic
1001211418 5:169813466-169813488 TTTTCTTTCTGGAAAAACAATGG + Intronic
1001662168 5:173402492-173402514 TTTTTTTTCTAGAAAAATAAGGG + Intergenic
1001689755 5:173624292-173624314 TTTTCTTTCTAGAATCATCATGG - Intergenic
1002331104 5:178441630-178441652 TTGTCTTTCTCCAAACATCAGGG - Intronic
1003777206 6:9381139-9381161 TTGTTTTTCTAGTAACATAAGGG + Intergenic
1004314310 6:14572626-14572648 AGGTGTTTCTAGAACAATGAGGG + Intergenic
1004469705 6:15918519-15918541 TTGCATTTCTAGAAAAATGCGGG - Intergenic
1004776385 6:18850594-18850616 TGGAGTTTCTATAAAAATGATGG + Intergenic
1005189200 6:23200515-23200537 TTGTCCTCCCAGAAAAATGAGGG - Intergenic
1005808981 6:29502107-29502129 TTGTATTTCTTTAAAAATCATGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007123834 6:39407437-39407459 TTGTCTTCCAACAAAAAGGAGGG + Intronic
1007983344 6:46181840-46181862 TTATTTTTCTATAAAAATGCTGG + Intergenic
1007988897 6:46234535-46234557 TTGTCTTTTCAGAGAAATGCTGG - Intronic
1008018899 6:46553429-46553451 ATTCCTTTCTAGAAAAATAAGGG + Intronic
1008334651 6:50287270-50287292 TTGTATTTCTAGTAAAGTCAGGG + Intergenic
1008755041 6:54784881-54784903 TTGTCTTTGTAGAAAACCCATGG + Intergenic
1008879460 6:56366025-56366047 TTGTCTTACTTGAAAATTCAAGG + Intronic
1008915938 6:56786703-56786725 TTGTCTTTTTAGAAGAAACAAGG + Intronic
1009335254 6:62480390-62480412 TTGTCCTTCAAGAAAGAGGATGG + Intergenic
1009524387 6:64725489-64725511 TTATCTTCCTAGAGAAATGAAGG + Intronic
1009882026 6:69580483-69580505 TGGTGACTCTAGAAAAATGAGGG - Intergenic
1010059182 6:71602775-71602797 GTGTCTGTCAATAAAAATGAGGG - Intergenic
1010104164 6:72148348-72148370 TTCTCTTTCTAGAAAAACCTGGG + Intronic
1011880189 6:92014752-92014774 AAGTCTTCCTAGAAAACTGATGG - Intergenic
1011898222 6:92259137-92259159 TTGTCTTTTTAAAAAGATTAGGG - Intergenic
1012776353 6:103497954-103497976 TTGTATTTCTAATTAAATGAGGG - Intergenic
1013160115 6:107535065-107535087 TTGTCTTTCTATAATTCTGAAGG + Intronic
1013457208 6:110341017-110341039 TTTTTTTTCCAAAAAAATGAAGG + Intronic
1013531888 6:111027254-111027276 TCCTCTTGCCAGAAAAATGAAGG + Intronic
1014888633 6:126814173-126814195 TGCTCTTCCTAGAAAAATAAAGG - Intergenic
1015300331 6:131645697-131645719 TTGTTTTTCTAGAAATCTGAAGG + Intronic
1016714533 6:147209508-147209530 TTTCCTTACTATAAAAATGAAGG + Intronic
1017093624 6:150783842-150783864 TTATTTTTCTAGAAATATGTGGG - Intronic
1017819952 6:158042031-158042053 TTGTCTTTATATACAAATGTTGG + Intronic
1018301866 6:162411358-162411380 TTTACTTTCTAGACAAAAGATGG + Intronic
1018341219 6:162852887-162852909 TTGGCTTTCAAGAAAATTGAAGG - Intronic
1018776123 6:167017861-167017883 TTGTCTTTTCATAAAAGTGAGGG - Intronic
1019835515 7:3379141-3379163 TTAAATTTCTAGAAAAGTGACGG - Intronic
1021565266 7:22010469-22010491 TTCTCTTTTTTGAAAAATGGGGG + Intergenic
1021782955 7:24123915-24123937 TTCTTTTACTAGAAAAATAATGG - Intergenic
1021963590 7:25895680-25895702 TGGTGTTTCTGGAAAAATCAGGG + Intergenic
1022023641 7:26425763-26425785 TTATCTTTCTATAAAATGGAGGG - Intergenic
1023073273 7:36458785-36458807 TTTGCTTTCAACAAAAATGAAGG - Intergenic
1025624140 7:63203449-63203471 GTGACTTTAGAGAAAAATGAAGG - Intergenic
1026435165 7:70390324-70390346 GTGTCTTTTTAGAAAGGTGATGG + Intronic
1027008290 7:74717660-74717682 TTTTCATTCTAGAAAAATAAGGG - Intronic
1027426154 7:78063090-78063112 TGGGCTTTATAGAAAAATGCAGG - Intronic
1027589963 7:80106114-80106136 TTCTCTTTCTCAAAAAAGGAAGG - Intergenic
1027609607 7:80343744-80343766 TTTTCTTTCTATAAAAATTGCGG - Intergenic
1027771520 7:82412907-82412929 TTGTCATTTGAGAAAAATAACGG - Intronic
1028297329 7:89150439-89150461 TTGTCTTGTTAGAAAAAGCATGG + Intronic
1028623627 7:92852153-92852175 TTAACTTTCTATAAAAAGGAAGG - Intergenic
1028728190 7:94113217-94113239 TTGTCTTTGTAGAAAAAGTTAGG - Intergenic
1028744533 7:94312307-94312329 TTTTCTTTCAAGAAAAAAAAAGG - Intergenic
1028963948 7:96780554-96780576 TTTTCTTGCTTGTAAAATGAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029999700 7:105046257-105046279 ATGTGTTTTTAGAAAAATTATGG - Intronic
1030980942 7:116185242-116185264 TTTTCCTAGTAGAAAAATGATGG + Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032066012 7:128771492-128771514 TTCTATTTCTTGGAAAATGAAGG - Intronic
1032371005 7:131351721-131351743 TGGTCTTTCTAAAAAACTGATGG - Intronic
1032452488 7:132045270-132045292 TTCTCTTTCTATAAAGATGTGGG - Intergenic
1032606467 7:133360065-133360087 CTGTCTTTCTAGAGAAATAATGG - Intronic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033155129 7:138950413-138950435 TTGTCTTTCAAGAAAGGAGAAGG + Intronic
1033923038 7:146419059-146419081 TTTTCTTTATAGAAAAATAAAGG - Intronic
1033997728 7:147372679-147372701 TTGTCTCCCTTGAAAATTGATGG + Intronic
1034194445 7:149235291-149235313 TTTTCTTTCACTAAAAATGAGGG + Intergenic
1035793671 8:2333101-2333123 TTCTCTTTCTAGTATAATTAGGG - Intergenic
1035799132 8:2388604-2388626 TTCTCTTTCTAGTATAATTAGGG + Intergenic
1035962478 8:4152963-4152985 TTGTCATAGCAGAAAAATGAAGG - Intronic
1036031733 8:4981399-4981421 TTGGATATCTAGAAAAATGAGGG - Intronic
1036921573 8:12860555-12860577 TTGTGTTTTTAGAGAACTGATGG - Intergenic
1037022832 8:13995203-13995225 CTTTATTTCTAGAAAATTGAAGG - Intergenic
1038609109 8:29043022-29043044 TTGTCTTTCTAGAAAACAGATGG + Intronic
1038760773 8:30383352-30383374 TTTTTTTTTTAGAAAAATGAGGG - Intergenic
1039033498 8:33333968-33333990 TTTTCTTTTTAGAAAAATGAAGG - Intergenic
1039039830 8:33396483-33396505 TAGTATTTTTAGAAAAATCAAGG - Intronic
1039977463 8:42379614-42379636 TAGACTTTCTAGAGAAATAAAGG + Intergenic
1040012973 8:42677595-42677617 CAGTCTTCCTAGACAAATGAAGG - Intergenic
1041533254 8:58895835-58895857 TTCTCTGTCTACAAAAATGGAGG + Intronic
1041549520 8:59084324-59084346 TTTACTTTTTAGAAAAATAAGGG + Intronic
1041703278 8:60815813-60815835 TGGTCCTTCTAGAAAAATCTAGG - Intronic
1042506700 8:69568296-69568318 CTGTTTATCTAGAAAGATGAAGG + Intronic
1043008668 8:74854502-74854524 TTGTTTTTAGAGAAAAAAGAGGG - Exonic
1043029793 8:75119974-75119996 TTCTCTTTGTAGAAAAATTTAGG + Intergenic
1043418998 8:80079932-80079954 TTTTCTCTTTAGTAAAATGATGG - Intronic
1043534786 8:81190441-81190463 TTATATTTTTTGAAAAATGAAGG + Intergenic
1043587423 8:81785106-81785128 TGGAGTTTCTAGAAAAATGATGG - Intergenic
1044946094 8:97391480-97391502 TTGTATCTCTAGTAAAATGCAGG - Intergenic
1045614379 8:103891154-103891176 TACTCTTTTTAAAAAAATGATGG - Intronic
1045683636 8:104688935-104688957 TTCTCTTCCTAGAAAAGAGAAGG + Intronic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1045886026 8:107098748-107098770 TTGTGTTTCTAGGTAAATAAGGG + Intergenic
1046907163 8:119586374-119586396 TTCTCTCTCTAGAAAGCTGAAGG + Intronic
1048497922 8:134950545-134950567 TTGCATATATAGAAAAATGAAGG + Intergenic
1048774288 8:137928636-137928658 TTTATTTTATAGAAAAATGAAGG - Intergenic
1048950913 8:139496062-139496084 TTGCCTCTCTTGAAAAATAAGGG + Intergenic
1049281448 8:141750151-141750173 TTGTCTTTGTAGAAAATCTAAGG + Intergenic
1049303551 8:141884659-141884681 TTGGCTCTGTAGAAAAATGGGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050748129 9:8901974-8901996 TTTTCTTACTTGAAAAATAAGGG + Intronic
1050958821 9:11700844-11700866 TTGTATTTTTAAAAAAATCAAGG - Intergenic
1051235855 9:14998031-14998053 TTCTCTTACTAGAAACATCATGG - Intergenic
1051320687 9:15901997-15902019 TTTTCTTTCAAAAAAGATGAGGG + Intronic
1051524151 9:18023760-18023782 TAGTCTTTCAAGAAACATAAGGG - Intergenic
1051605853 9:18917285-18917307 TTGTTTTGCTGAAAAAATGATGG + Intergenic
1051764469 9:20507416-20507438 TTCTCATTTTAAAAAAATGAAGG - Intronic
1052372872 9:27685511-27685533 TTGTCTATCAGGAAATATGAAGG + Intergenic
1052587611 9:30449398-30449420 TTTTCTTTCATGAAAAATGAGGG - Intergenic
1054932861 9:70654221-70654243 TTGTTTTTATAGGTAAATGAGGG + Intronic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056458409 9:86785599-86785621 TTGTATTTCAAGTAAAATGGAGG - Intergenic
1056729048 9:89148294-89148316 TTGTAGTTCAAGAACAATGAGGG + Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1186139321 X:6554457-6554479 GTGTCTTGGGAGAAAAATGATGG - Intergenic
1186562938 X:10632230-10632252 TTGTTTTTTTAGACATATGAGGG - Intronic
1187521294 X:20016644-20016666 TTGTCATTCAATAAGAATGATGG - Intronic
1187892886 X:23953778-23953800 TTGTCTTTATAGTCAAATCAAGG + Intergenic
1188308131 X:28584257-28584279 TTTTCTTTCCAGTAATATGATGG - Intergenic
1188333603 X:28900386-28900408 TAGTTTTTCTACAAAAATCAAGG + Intronic
1188354562 X:29175208-29175230 TAATCTTTAAAGAAAAATGATGG + Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1188809067 X:34630044-34630066 TCGTTTTTCTTGACAAATGAAGG - Exonic
1189187686 X:39068333-39068355 ATGACTTTCTAGAAAACTGTAGG - Intergenic
1189199376 X:39178580-39178602 TTGCCTTTCTATATAAATGTTGG + Intergenic
1190145225 X:47884932-47884954 TTGCCTTTCATGAAAAAGGAAGG + Intronic
1192695560 X:73411882-73411904 AAGTATTTCTACAAAAATGATGG + Intergenic
1192810801 X:74545702-74545724 TTGTTTTTCTACAAAATTGATGG - Intergenic
1193179520 X:78437931-78437953 TTGTCTTTCTAGTAAACTGCAGG - Intergenic
1193213480 X:78835710-78835732 TTGACTGTCTAGTAAAATAAAGG + Intergenic
1193281868 X:79660733-79660755 TTTAGTTTCTTGAAAAATGATGG + Intergenic
1193980371 X:88175240-88175262 TTTTCTTTCTTGTAACATGATGG + Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195600043 X:106736124-106736146 TTGTCATTCTAGAAAATAGGAGG + Intronic
1195666250 X:107433742-107433764 TTGTCTTCCTAGAAAGAGGGAGG - Intergenic
1195808074 X:108798000-108798022 TTGTCTTACCAGAAGCATGAAGG + Intergenic
1196067786 X:111484252-111484274 TTTTCTATCCAGGAAAATGATGG - Intergenic
1196460791 X:115928151-115928173 TTTTCTTTTTAAAAAAATTATGG - Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196561707 X:117157166-117157188 ATGTCTTTCTTGGAAGATGAAGG + Intergenic
1196772770 X:119311337-119311359 TTGTTTTCATAGATAAATGAGGG + Intergenic
1197032903 X:121839828-121839850 TTTTCTTTCTAAGAAAATAATGG + Intergenic
1197276493 X:124485472-124485494 AGATCTTTCTAGAAAAAAGAAGG + Intronic
1198003200 X:132462046-132462068 TTGTCTTCTCTGAAAAATGAGGG - Intronic
1198171854 X:134114735-134114757 TTTTCAGGCTAGAAAAATGAAGG - Intergenic
1198524261 X:137484546-137484568 TTGTCTTTTGAGAAAAAATATGG - Intergenic
1198953005 X:142094304-142094326 TTGTTTTTCTTAACAAATGAGGG + Intergenic
1199153294 X:144516037-144516059 TTGTTTTTGTGGAAAGATGAAGG - Intergenic
1199312268 X:146334910-146334932 TTTTTCTTCTTGAAAAATGATGG + Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1199878009 X:151950369-151950391 TTCCCTTTCCAGAAAAAGGAAGG + Intergenic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1201257895 Y:12127561-12127583 TTATCTTTCGATAAGAATGAGGG - Intergenic
1201490093 Y:14530822-14530844 TTGACTTTCAATAAATATGAAGG + Intronic
1201523590 Y:14904985-14905007 TTGTCTGTCTATAGATATGAGGG - Intergenic
1201536920 Y:15059394-15059416 TTGTCTTTTTTGAAATTTGAGGG - Intergenic