ID: 962575374

View in Genome Browser
Species Human (GRCh38)
Location 3:136751641-136751663
Sequence GGGCCTGGGGGGTCGCTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962575374 Original CRISPR GGGCCTGGGGGGTCGCTCGG CGG (reversed) Intronic
900013833 1:136115-136137 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
900043903 1:492098-492120 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
900065340 1:727101-727123 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
900100456 1:960115-960137 AGGCCTGGGGGGCTCCTCGGAGG + Intergenic
900106639 1:984238-984260 GGGCCTGGGGGGCAAGTCGGGGG + Intergenic
900122637 1:1055358-1055380 GGCCCTGTGGGGTCACCCGGAGG - Exonic
900129200 1:1080464-1080486 GGGCCTGGGGGGCTGCTCAGAGG + Intergenic
900189970 1:1349201-1349223 GGGCCTGGGCGGTCGGGCGGGGG - Intronic
900380502 1:2381731-2381753 AGGCCTGGGGGGCCGCTTGGGGG + Intronic
900529308 1:3144927-3144949 GGCCCTGGGGGTTCACTGGGAGG - Intronic
900566113 1:3332730-3332752 GGGCCTGGGGGGACGGGCGGTGG - Intronic
900566128 1:3332780-3332802 GGGCCTGGGGGGATGGGCGGAGG - Intronic
901109817 1:6785594-6785616 GGGGCTGGGGGGCGGCGCGGCGG + Intronic
901226575 1:7616559-7616581 GGGCCTCGGGGGTGACTGGGGGG + Intronic
901654753 1:10762894-10762916 GGCCCTGGTGGGACGCTCGTTGG + Intronic
902166100 1:14572732-14572754 GGGAGTGGGGGGCCGCTCCGCGG - Intergenic
902232484 1:15036588-15036610 GGGCCTGGGGTGCAGCTCGTGGG + Intronic
903284040 1:22266213-22266235 GGGCCTGGGGGGCCTCCTGGGGG + Intergenic
903349586 1:22710172-22710194 GGGCCTGGGGTGGGGCTGGGGGG - Intergenic
903466368 1:23554934-23554956 GGGCCCTGGGGGCCGCTCGCAGG - Intergenic
904605831 1:31697064-31697086 GGGCCTTGGAGGTCTCTGGGGGG + Exonic
905851300 1:41277125-41277147 GGGTCTGGGGGGTTGCTGGGTGG + Intergenic
907442567 1:54488255-54488277 GCGCCTGGGGCGGCGCTGGGGGG + Intergenic
911219847 1:95234577-95234599 GGGCCTGGGGGTGCGCACGCAGG - Intronic
911716142 1:101135178-101135200 GGGGTTGGGGGGTAGCTCAGGGG - Intergenic
915460235 1:156066115-156066137 GGGCCTGGGGGGCTGCTGGGTGG + Intronic
917541237 1:175916655-175916677 GGGCCTGGGGAGCTTCTCGGTGG + Intergenic
919296221 1:195703851-195703873 GGGTCTGGGGGGTCACACTGAGG + Intergenic
922734503 1:227971993-227972015 GGGCCTGGGAGGTCGCAGTGGGG + Intergenic
922734784 1:227973124-227973146 GGGCCTGGGAGGTCGCTGTGGGG + Intergenic
923630135 1:235644370-235644392 GGCCGAGGAGGGTCGCTCGGTGG - Intronic
924343427 1:243054712-243054734 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
1062821938 10:541457-541479 GGGGGTGGAGGGTCACTCGGGGG - Intronic
1062971776 10:1654006-1654028 GGTCCTGGGGGCTGGCTCTGTGG + Intronic
1064612151 10:17114742-17114764 GGGCATGGAGGGTCGTTCTGGGG + Intronic
1066460507 10:35608455-35608477 GGTCCTGGGCGGCCTCTCGGTGG - Exonic
1067686108 10:48466756-48466778 GGGCCTGGGGCGGCGCTGGCCGG - Intronic
1070787666 10:79171335-79171357 TGGCCTGGGCTGTCGCTCAGAGG + Intronic
1070789566 10:79181219-79181241 GGGCCTGGGAGGAGGCTCAGGGG + Intronic
1073412061 10:103350674-103350696 GGCCCAGCGGGGTCGCGCGGGGG + Intronic
1075330417 10:121570060-121570082 GGGCTTGGGGGGCCACTGGGTGG - Intronic
1076114069 10:127883090-127883112 GAGCCTGGGGTGTTGCTGGGTGG - Intronic
1076970177 11:128329-128351 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
1076993835 11:289089-289111 GGGCCCGGGCGGTCGCTGGGAGG - Intergenic
1077032828 11:477404-477426 GGGCCTGGGGGGTGGCCCTGGGG + Intronic
1077049998 11:562340-562362 GAGGCTGGGGGCTGGCTCGGGGG - Exonic
1077205026 11:1337766-1337788 GGGCCTGGGGGGCGCCTCCGGGG + Intergenic
1077250004 11:1556846-1556868 GTGCCTGGGGAGTCGAGCGGCGG + Exonic
1077254529 11:1574305-1574327 GGGCCTGGGCTGTCCCTGGGGGG + Intergenic
1081486370 11:43533011-43533033 GGGACTGGGGAGTCACTGGGGGG - Intergenic
1081493026 11:43581647-43581669 GGGGCGGGGGACTCGCTCGGAGG - Intronic
1081831905 11:46121520-46121542 GGGCCGGCGGGGCCGCGCGGCGG - Intergenic
1083664592 11:64267580-64267602 GGGCCAGGGCGGGCGCTGGGTGG + Intronic
1084173030 11:67409693-67409715 GGGCCTGGGGGGCCCCTCGATGG - Exonic
1085083653 11:73652694-73652716 GGGCTTGGGTGGTCTCTCAGGGG - Intronic
1089158673 11:116421542-116421564 GGTCCCGGTGGGTGGCTCGGTGG - Intergenic
1090561625 11:127938753-127938775 GGGCCTGGGGGGTCCTGCAGTGG - Intergenic
1091732517 12:2891281-2891303 GGGCCTCGGGTTTCCCTCGGGGG + Intronic
1092365450 12:7873122-7873144 ACGCCTGAGGGGGCGCTCGGAGG - Intronic
1092383657 12:8019003-8019025 ACGCCTGAGGGGGCGCTCGGAGG - Intergenic
1096260137 12:50085291-50085313 GGCGCTCGGGGGGCGCTCGGGGG + Exonic
1097003791 12:55900624-55900646 AGGGCTGGGGGGACACTCGGCGG + Intergenic
1097192324 12:57225427-57225449 GGGCTTGGGGGCTCCCTCGGGGG + Exonic
1105916571 13:24922650-24922672 GGACCTCGGGGTTGGCTCGGCGG - Intronic
1107295060 13:38899434-38899456 GGGCCTGGGAGGTCGGTAGGAGG - Intergenic
1112369380 13:98781803-98781825 GGTCCTGGGGGCCCGCTCTGAGG - Intergenic
1112434750 13:99383860-99383882 GGGCCTGGGTGGTCACTGGGAGG + Intronic
1113902013 13:113802797-113802819 GGGCTTGGGGGGCCACTGGGTGG - Intronic
1117131930 14:52695593-52695615 GGGCCTGGGAGGCGGCCCGGAGG - Exonic
1117546718 14:56798843-56798865 GGGCCTGGGGGGTCACCCACAGG + Intergenic
1120880157 14:89409348-89409370 GGGACGGGGGGGTCGCATGGCGG + Intronic
1121584299 14:95052319-95052341 GGGCCTGGGGGGTGGCAGGCAGG - Intergenic
1122308621 14:100780873-100780895 GGCCCTGGGGGGCTGCTCAGAGG + Intergenic
1122402523 14:101475688-101475710 GGGCCTGGGGGGCCCCACTGGGG - Intergenic
1122810843 14:104287222-104287244 GGGCCTGGGAGGTGGCTTGAAGG - Intergenic
1123020891 14:105397474-105397496 AGGCCTGAGGGGTGCCTCGGTGG - Exonic
1125588159 15:40836778-40836800 GGGCCTGTGGGGTAGGTTGGAGG + Intergenic
1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG + Intronic
1129220542 15:74129417-74129439 GGGCCATGGGGGTCTCTCGATGG - Exonic
1129297036 15:74605127-74605149 GGGCCTGGGGGCTCACTGGATGG + Intronic
1129612316 15:77070788-77070810 GGGCCTGGGCGGGCGCGCGGGGG - Intronic
1132501445 16:286266-286288 GGGCCTGGGGGGTGGGGGGGAGG - Intronic
1132571910 16:647907-647929 GGGGCTGGGGGGTCTCTCCTGGG - Intronic
1133629132 16:7602378-7602400 GGGGCTGGGGGGGCCCTGGGAGG + Intronic
1133739322 16:8639792-8639814 AAGCCTGGGGGGCTGCTCGGAGG - Intronic
1135590361 16:23700824-23700846 GGGCCTGGGGAGCTGCTGGGAGG + Intronic
1136095692 16:27954491-27954513 GGGCCTGGGAGGTATCTCAGTGG - Intronic
1136260234 16:29069913-29069935 GGGCCTGGTGGCTGGCTCTGAGG - Intergenic
1136455696 16:30378567-30378589 GGACCTGGGGCATCGGTCGGGGG + Intronic
1136472294 16:30489198-30489220 GGCTCTGGGGGGTGGGTCGGTGG + Intronic
1137262789 16:46844615-46844637 GGGCATGTGCGGGCGCTCGGTGG + Intergenic
1138320438 16:56106605-56106627 GGGCCTGTGGGGTCACTGTGAGG - Intergenic
1142119022 16:88376899-88376921 GGGCCTCGGGGCACGCTGGGAGG - Intergenic
1142335743 16:89489386-89489408 GGGTGTGGGGGGTGGCTGGGAGG - Intronic
1142450500 16:90170803-90170825 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
1142457062 17:62888-62910 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
1143863068 17:9905200-9905222 GCGGCTGGGGAGTCGCTGGGTGG + Exonic
1144923157 17:18781310-18781332 GGGGCTGAGGGCTCGCTGGGAGG + Intronic
1145009973 17:19362454-19362476 GGGCCCCGGGGGACGCTGGGGGG + Intronic
1146079130 17:29761369-29761391 GGGCCCGCCGGGTCGCGCGGAGG + Intronic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1147293416 17:39461771-39461793 GGGCCTGAGGACTGGCTCGGCGG + Intronic
1147317680 17:39628573-39628595 GGGCCTGGGGGACCTCTCTGGGG - Intronic
1147561147 17:41510034-41510056 GGGCCTGGGGTGACTCTCTGGGG - Intergenic
1147582781 17:41636483-41636505 GGGCCTGGGGGGGGGGTCAGTGG - Intergenic
1149623315 17:58062043-58062065 GGGCCTTGGGGGCCACTCAGAGG + Intergenic
1150003212 17:61454848-61454870 CGGCCTGCGGGGTCGCAAGGAGG - Intronic
1152049024 17:77958511-77958533 GGGCCGGGAGGGGCGCGCGGGGG + Intergenic
1152458989 17:80431603-80431625 GGGCCTGAGGGGCCGCACTGGGG - Intronic
1152690767 17:81716739-81716761 GGGCCTGGGAGGACCCTCTGTGG + Intronic
1154266660 18:12884356-12884378 GGGCGGGGCGGGGCGCTCGGGGG + Intronic
1160559673 18:79748376-79748398 GGGCCTGGGGGGACCCATGGAGG + Intronic
1160646975 19:198247-198269 GGGCCTGGGAGGTCGCGGTGGGG - Intergenic
1161096732 19:2396463-2396485 GGGCCTGGGTGGCAGCTCAGCGG + Intronic
1161297128 19:3525803-3525825 TGGCCTGGGGGCACTCTCGGGGG + Intronic
1161793260 19:6373245-6373267 GGGCCAGGGGGGTCGGGCGCAGG + Intronic
1161961813 19:7527538-7527560 GGGCGGAGGGGGCCGCTCGGGGG - Exonic
1161976529 19:7610806-7610828 GGGCCTGGGGGCCGGGTCGGGGG + Intronic
1162408687 19:10491544-10491566 GGGCCTGGGGGTGGGCTCGGAGG - Intronic
1163152701 19:15424540-15424562 GCGCCTGGGGAGTGGCTGGGTGG + Intronic
1163334312 19:16661090-16661112 GGGCCTGGGGTGGCGCCTGGCGG + Intergenic
1163585433 19:18161188-18161210 GAGCCTGGCGGGTAGCCCGGGGG + Intronic
1163593672 19:18208464-18208486 GGGGTTGGGGGGTGGGTCGGAGG - Exonic
1164594751 19:29525835-29525857 TCTCCTCGGGGGTCGCTCGGAGG - Intergenic
1165772797 19:38388552-38388574 GGGGCTGGGGGGTTGCTCTCTGG + Intronic
1167307982 19:48719857-48719879 GGGCCTTGGGGGATGCTGGGGGG + Intergenic
1167380087 19:49133533-49133555 GGGCCTGGAGGTTTGCGCGGGGG + Intronic
1167638405 19:50667820-50667842 GGGCCTGGGAGGCGGCTGGGGGG + Exonic
1168316415 19:55486611-55486633 TGGCCTGGGGGGCCCCTGGGTGG + Exonic
925444909 2:3919319-3919341 GGGCCTGGGTGATGGCACGGTGG + Intergenic
926146002 2:10397501-10397523 GGGCCTGGGGGGCTGCAGGGTGG - Intronic
928303718 2:30147925-30147947 GGGCCGGCGGGGGCGCTCGCGGG + Intronic
928511925 2:32010583-32010605 GGGCCGTGGGGGCGGCTCGGCGG - Intronic
929905312 2:46040516-46040538 GGGCCTGGGGGAGCACTCTGGGG + Intronic
932036475 2:68251982-68252004 GGGCCCGGCGGGTCCCGCGGCGG - Intronic
932769169 2:74490876-74490898 GGGACTGGGGGGTCTCTCACAGG + Intronic
938302736 2:130228397-130228419 AGGCCTGGGGGGCTTCTCGGAGG - Intergenic
938453933 2:131445825-131445847 AGGCCTGGGGGGCTTCTCGGAGG + Intergenic
938454026 2:131446076-131446098 GGGCCAGGGGGGCTTCTCGGAGG + Intergenic
946433448 2:219637681-219637703 CGGGCTGGGGGGGCCCTCGGTGG - Exonic
948862693 2:240760640-240760662 GGGGCTGGAGGGCCGCTGGGTGG - Intronic
948983832 2:241508365-241508387 GGGCCCGGGGCGGGGCTCGGTGG - Intronic
1168904496 20:1392676-1392698 AGGCCTGGGCGGTGGCTCAGGGG - Intronic
1168961022 20:1869974-1869996 GGGCCTTGGGGGTCACTCTAAGG + Intergenic
1168965952 20:1898046-1898068 CGGCCTGGGGGGTGACTCAGAGG - Intronic
1169116922 20:3072019-3072041 GGCGCTGGGGACTCGCTCGGAGG - Intronic
1169262434 20:4148730-4148752 GGGCCCGGGGAGGAGCTCGGCGG + Intronic
1171012333 20:21515321-21515343 GGGGGAGGGGGGTCGCTGGGTGG + Intergenic
1171223395 20:23421067-23421089 GGGCCTGTGGGGTCTCTGGAGGG + Intronic
1172174040 20:32961533-32961555 AGGCCTTGGGGGCCGCTCGAAGG - Intergenic
1173516246 20:43667273-43667295 GGGCCGGGGGGATGTCTCGGCGG + Exonic
1174246822 20:49188072-49188094 GGGCCTGGTGGGGCCCTCGCGGG - Intronic
1176550131 21:8217307-8217329 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1176569059 21:8400342-8400364 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1176576973 21:8444577-8444599 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1178639758 21:34336403-34336425 GGGCCTGGGGGGTGGGGTGGAGG + Intergenic
1178670814 21:34590184-34590206 GGCCCTGGAGGGCCGCTCTGAGG - Intronic
1179675062 21:42975178-42975200 GGGCCGGCGGGGCTGCTCGGAGG + Intronic
1180075077 21:45458003-45458025 GGGCCTGGGGAGTGGCCGGGGGG + Intronic
1180614894 22:17120665-17120687 GGGCCCCGGGAGCCGCTCGGCGG - Exonic
1180843599 22:18970355-18970377 GGGCCTGGGCGGGGGCTGGGGGG - Intergenic
1182091286 22:27596653-27596675 GGGCCTGGGAGGCCGCTTCGTGG - Intergenic
1183282082 22:36937493-36937515 GGGGCTGGGGGGCTGCTCTGTGG - Exonic
1183391188 22:37546376-37546398 GGGCCTGTGGGGGTACTCGGGGG + Intergenic
1184101779 22:42344632-42344654 GGGACTGGGTGGCCACTCGGGGG - Intergenic
1184545564 22:45164603-45164625 GGGCCGGGCGGGGCGCGCGGTGG + Intronic
1184662020 22:45969832-45969854 GGGCTAGGAGGGTCGCTGGGTGG - Intronic
1184688837 22:46108411-46108433 GGGCCTGTGGGGACACTGGGTGG - Intronic
1185313658 22:50169993-50170015 GGGGCGGGGGCGCCGCTCGGTGG - Intergenic
1185344576 22:50305739-50305761 GGGCCTGGAGGGTACCTCAGAGG + Intronic
1185370728 22:50459793-50459815 AGGGCTGGGGGGTGGCTGGGGGG - Intronic
1203255024 22_KI270733v1_random:133639-133661 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1203263080 22_KI270733v1_random:178718-178740 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
950132011 3:10553824-10553846 GGGCCTGGGTGGTTGCTAAGCGG + Intronic
950193282 3:10992599-10992621 GGGCCTGGGGGAGCGCTGGGCGG + Intergenic
952347477 3:32502414-32502436 GGGACTGAGGGGCCGCCCGGCGG + Intronic
954448877 3:50561110-50561132 GGGCCTGGAGGGCTGCTGGGAGG - Intronic
954686298 3:52372084-52372106 GGGCCTGGGGGGGTGCTCACGGG - Exonic
954778835 3:53045244-53045266 GGGCCCGGGCGGTCGCTGCGCGG - Intronic
955769107 3:62371970-62371992 GGGCCGGGAGGGGCGATCGGCGG - Intronic
962235376 3:133702214-133702236 GGGCCTGTGGGGTGGGTGGGAGG - Intergenic
962482076 3:135806631-135806653 GGGCCTGGGGGCTCTCTTGGAGG + Intergenic
962575374 3:136751641-136751663 GGGCCTGGGGGGTCGCTCGGCGG - Intronic
964209635 3:154212599-154212621 GGGGCTGGGGGGTAGGTGGGTGG + Intronic
966924667 3:184636504-184636526 GGGCCTGGGGAGTCTCTCTGAGG - Intronic
968370707 3:198221276-198221298 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
968452536 4:682083-682105 GCGCACGGGGAGTCGCTCGGTGG + Exonic
968601403 4:1511671-1511693 GGGGCTGGGGGACCGCTCTGGGG - Intergenic
968809393 4:2793164-2793186 GGGTCTCGGGGGTCTCGCGGGGG + Intronic
969064517 4:4467738-4467760 GGGCATGGGGGGTGGGTGGGAGG + Intronic
970120283 4:12745964-12745986 GGGCCTTGGGGGACGCAGGGAGG + Intergenic
982005308 4:151057747-151057769 AGGGCCGGGGGGTCGGTCGGTGG + Intergenic
985624382 5:977456-977478 GGGCCAGGGTGGTGGCTCTGTGG + Intergenic
985875523 5:2591263-2591285 GGGCCTGAGGGGTCCCAGGGAGG + Intergenic
986333316 5:6734187-6734209 GGGCCAGGGAGGCCGCTGGGTGG + Intronic
987023776 5:13902381-13902403 GAGCCTGGGGGGTGGCACTGGGG + Intronic
993384696 5:87251053-87251075 GGGGATGGGGGGTGGCGCGGGGG - Intergenic
993852018 5:93022235-93022257 GGGGCTGGGGGGTGGGTGGGGGG + Intergenic
994802755 5:104399766-104399788 GGGCCTGTCGGGGGGCTCGGGGG + Intergenic
997443863 5:133927269-133927291 GTGCCTGGGGTGTCGCTAGCAGG - Intergenic
1001664633 5:173422127-173422149 TGGCCTGGAGAGTGGCTCGGAGG - Intergenic
1001823174 5:174725312-174725334 GGGTTTACGGGGTCGCTCGGTGG + Intronic
1002729940 5:181326831-181326853 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
1003218471 6:4135890-4135912 GGGCCGGGGGGGTCGGTGCGTGG + Intergenic
1005773739 6:29105917-29105939 GGGCCTGTGGGGGCGGTGGGGGG - Intergenic
1006339351 6:33438054-33438076 GGGCTCGGGGGGTGGCTCAGGGG + Exonic
1007761616 6:44136584-44136606 GGGCCTGGGGGGTCATCCTGTGG - Intronic
1013117565 6:107114763-107114785 GGGGCGGGGGGTTCGCGCGGTGG - Intronic
1019305518 7:332690-332712 GGGCCTGGGGAGAGGCTTGGAGG + Intergenic
1019492318 7:1321273-1321295 GGGCCTGGGGGCTTGCGCTGAGG + Intergenic
1025023036 7:55495041-55495063 GGGGCTGGGGGGTCGGGGGGAGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032051610 7:128653755-128653777 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
1034490931 7:151392678-151392700 AGGCCTGGGAGGTCCCTGGGCGG - Intronic
1035224952 7:157427900-157427922 AGGCCTGGGGGGACCCCCGGGGG + Intergenic
1035467116 7:159086721-159086743 GGTCCTGGGCAGGCGCTCGGAGG - Intronic
1039307183 8:36275275-36275297 GGGCAAGGGGGGTCTCTGGGAGG + Intergenic
1041304669 8:56446823-56446845 GGGCCACAGGGGGCGCTCGGTGG + Intergenic
1047940942 8:129826911-129826933 GGGCCTGAGGGGTCACACTGAGG + Intergenic
1055959176 9:81803720-81803742 GGGCCAGGGGGCTCTCTGGGGGG + Intergenic
1057693896 9:97310274-97310296 GGGCCTCGGGTGTCTCTTGGAGG + Intronic
1057706528 9:97398916-97398938 GGGCCTGGGAAGTCACTGGGTGG - Intergenic
1059375396 9:113876637-113876659 GGGCCGGAGGGGGCGCTGGGTGG - Intronic
1061295465 9:129674596-129674618 GGGGCGGGGGGGTCCCTCTGTGG - Intronic
1062020851 9:134318777-134318799 AGGCCTGGGGTCTCGCCCGGGGG + Intronic
1062255249 9:135617757-135617779 GGGCCTGGGAGGTCGCAGAGGGG + Intergenic
1062386955 9:136316330-136316352 GTGGCTGGGGTGTTGCTCGGTGG + Intergenic
1062425425 9:136503999-136504021 GGGGGTGGGGGGTCCCACGGTGG - Intronic
1062459981 9:136658985-136659007 GAGCCTCGGGGGTCGCCCGGGGG - Exonic
1062461411 9:136664047-136664069 GGGCCTAGGGGGCCTCTGGGTGG - Intronic
1062461689 9:136665077-136665099 GGGCCTGTGGATTCGCTGGGAGG + Intronic
1062754355 9:138279345-138279367 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
1203471424 Un_GL000220v1:116779-116801 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1203479245 Un_GL000220v1:160751-160773 GGGCCGGGGGGGTAGGGCGGGGG - Intergenic
1203578259 Un_KI270745v1:23505-23527 GGGCCTGGGAGGTCGCGGTGGGG + Intergenic
1185767943 X:2741108-2741130 GGGACGGGGGGGTGCCTCGGTGG - Exonic
1187332517 X:18354213-18354235 GGGCCTGGGGGGCATCACGGTGG - Intronic
1189578015 X:42375717-42375739 AGGCCTGGGGGGTCTCTGGCTGG + Intergenic
1189891983 X:45612652-45612674 GGGCCTGGGGGTTGGGTCTGTGG - Intergenic
1190614438 X:52216413-52216435 AGGGATGGGGGGTCGATCGGAGG - Intergenic
1192211246 X:69129207-69129229 GAGCCTGGTGGGTAGCTCTGAGG + Intergenic
1195210972 X:102651998-102652020 GCGCCTGGGGGGGCCCTCGTGGG + Intronic
1197776258 X:130120597-130120619 GGGCCTGCGAGGTGGCTCGAGGG + Intergenic
1198807624 X:140506104-140506126 GGGCCCGGCGGTTCGCCCGGAGG - Intergenic
1199685431 X:150260981-150261003 AGGCCTGGGAGGTGGCTCTGAGG + Intergenic
1199793885 X:151177646-151177668 GGAACTGGGGGGTCGCAGGGCGG + Intronic
1200216527 X:154370553-154370575 GGGCCTGGGGGGTCGGGCACTGG - Intronic