ID: 962579359

View in Genome Browser
Species Human (GRCh38)
Location 3:136783889-136783911
Sequence GTGATCACTCTGGCATCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962579355_962579359 7 Left 962579355 3:136783859-136783881 CCTGTCCTAATTCTGTTTTGAAT No data
Right 962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG No data
962579354_962579359 13 Left 962579354 3:136783853-136783875 CCTCATCCTGTCCTAATTCTGTT No data
Right 962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG No data
962579353_962579359 14 Left 962579353 3:136783852-136783874 CCCTCATCCTGTCCTAATTCTGT No data
Right 962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG No data
962579357_962579359 2 Left 962579357 3:136783864-136783886 CCTAATTCTGTTTTGAATGGAAC No data
Right 962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962579359 Original CRISPR GTGATCACTCTGGCATCCCA AGG Intergenic
No off target data available for this crispr