ID: 962588649

View in Genome Browser
Species Human (GRCh38)
Location 3:136866695-136866717
Sequence CACTTGAACCAAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181667
Summary {0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962588649_962588653 9 Left 962588649 3:136866695-136866717 CCTCCGTCTCCTTGGTTCAAGTG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
Right 962588653 3:136866727-136866749 TGTCAGTCTTCCGAGTAGCTAGG 0: 1
1: 18
2: 959
3: 16456
4: 157974
962588649_962588654 17 Left 962588649 3:136866695-136866717 CCTCCGTCTCCTTGGTTCAAGTG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
Right 962588654 3:136866735-136866757 TTCCGAGTAGCTAGGATTACAGG 0: 56
1: 3661
2: 62084
3: 233001
4: 266144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962588649 Original CRISPR CACTTGAACCAAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr