ID: 962594625

View in Genome Browser
Species Human (GRCh38)
Location 3:136928043-136928065
Sequence GGCCCAACAAGAACAAGAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962594624_962594625 -7 Left 962594624 3:136928027-136928049 CCAAATTTGATTATGTGGCCCAA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 962594625 3:136928043-136928065 GGCCCAACAAGAACAAGAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962594625 Original CRISPR GGCCCAACAAGAACAAGAGT TGG Exonic
900080109 1:850289-850311 GGCACACCAAGAACAAGAGCTGG + Intergenic
901034990 1:6331145-6331167 AGCCCCACAAGAACAAGAGACGG + Intronic
901830544 1:11889336-11889358 GGCGCACCAAGAAGAAGAGAGGG + Intergenic
904537183 1:31207599-31207621 GGGCAAAGAAGAACAAGAGTGGG - Intronic
906380238 1:45327824-45327846 GACTCAGCCAGAACAAGAGTGGG - Exonic
906731193 1:48082678-48082700 AGCCCATCAAGGACAGGAGTTGG - Intergenic
910778229 1:90897830-90897852 GGCCAAACAAGAACCAGAGTGGG - Intergenic
915120411 1:153626972-153626994 GGCCCAACATAAACAAGCTTTGG - Intronic
917001714 1:170367934-170367956 GGGCCAAGGAGAACAAGAGGAGG - Intergenic
917260379 1:173160579-173160601 GTCCCAACAAAAACAAGACCAGG + Intergenic
918370219 1:183853351-183853373 ATGCCAACAAGAACCAGAGTAGG + Intronic
919318274 1:196001864-196001886 GGCCCAACCAGATTGAGAGTGGG - Intergenic
920267559 1:204735389-204735411 GGCTCAACAAGAACAGGGTTTGG - Intergenic
920399243 1:205666924-205666946 GGCCCTCCCAGAACAAGGGTGGG - Intronic
922236419 1:223726034-223726056 GGCCCAACAAGAATGAACGTGGG - Intronic
923254439 1:232208995-232209017 GGCCATACAAGAACAAGTGATGG + Intergenic
1072104978 10:92265220-92265242 GGCCCAACAACCACAAGTCTTGG - Intronic
1076653691 10:132007268-132007290 GTCTCAAGAAGAACAAGAGGTGG - Intergenic
1083397504 11:62401744-62401766 GGCTCCATGAGAACAAGAGTTGG + Intergenic
1083817269 11:65141638-65141660 AGACCAACAATAACAAGTGTTGG + Intergenic
1086303059 11:85450489-85450511 GGCCAAAAAAGAAGATGAGTTGG - Intronic
1087424694 11:97971613-97971635 GGCTCAATAAGGAGAAGAGTTGG + Intergenic
1097059391 12:56271236-56271258 GTCCCAAAAATAACAAGAGGTGG - Intergenic
1097651275 12:62299818-62299840 GGACAGACAAGAACAAGTGTTGG - Intronic
1098618752 12:72564319-72564341 GGCAAAACAAGCACAAGCGTAGG + Intronic
1099978216 12:89568712-89568734 GGCCCAACCAGAAAAGGAGAAGG - Intergenic
1099995219 12:89770826-89770848 GGCCCAACAACAGTCAGAGTAGG - Intergenic
1100265500 12:92972234-92972256 GGCTCAAAAAGAACCAGACTAGG + Intergenic
1102297046 12:111745211-111745233 GGCACAGCAAGAGCAAGAGATGG - Intronic
1103537365 12:121642044-121642066 GGCCCAACAAATACAAGACACGG - Intronic
1109681866 13:65762471-65762493 GGCCCAAGAAGCAGAAGAGAGGG + Intergenic
1111174530 13:84577143-84577165 GGTCTAAAATGAACAAGAGTTGG + Intergenic
1112400641 13:99074831-99074853 GACCCAAAAAGAAGAAGAGGAGG - Intronic
1114200080 14:20511863-20511885 GGCCCAAAAAGAAAAAGAAGAGG - Intergenic
1115097247 14:29651765-29651787 TGCACAACAAGAACAAAACTCGG - Intronic
1116145579 14:41063715-41063737 GGCCCAACAGGAGCAAAAGATGG - Intergenic
1125484234 15:40101219-40101241 GAACCAACAAGAACAAACGTCGG + Intronic
1132596944 16:756519-756541 GGACCAACAATGACAAGTGTTGG - Intronic
1134333322 16:13270287-13270309 GACCCAACAAGAGCAGGAGTTGG + Intergenic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1151793022 17:76321592-76321614 GGTCCAACAAGAGGAAGAGACGG - Intronic
1152117317 17:78396502-78396524 GGGGCAACAAAAACAAGAGCTGG - Intronic
1156666806 18:39418481-39418503 GGAACAACAACAACAAGAGGAGG + Intergenic
1157277975 18:46325709-46325731 GGCACAACATGAACAAAGGTGGG - Intergenic
1158668763 18:59455963-59455985 GGGCCAGGAAGAACAAGAGATGG - Intronic
1159031043 18:63232628-63232650 AGCCCAACAATGTCAAGAGTGGG + Intronic
1159594400 18:70369219-70369241 GGCACAACATGAACAAAATTAGG + Intergenic
1160860213 19:1234470-1234492 GGGCCACCCAGAAAAAGAGTGGG + Intronic
1162565792 19:11445408-11445430 GGCCCAACAGGAGCAGGAGCTGG + Exonic
1163032319 19:14552834-14552856 GGCCCTATAAGAAAAAGACTGGG - Intronic
1164896429 19:31881327-31881349 GGCCCTACAGGAACAGGTGTGGG + Intergenic
1166006696 19:39913053-39913075 GGACCAAAAAGAACCAGAGAGGG + Intronic
1168430144 19:56272540-56272562 GGCCCTACAAAAACAGGAGGAGG + Intronic
925198863 2:1950246-1950268 GGCCCAATAAGAAACAGGGTTGG - Intronic
931196178 2:60054096-60054118 GGCCCAAGAACCACAAGAGATGG + Intergenic
931835914 2:66098101-66098123 GGCAAAACAGGAACAAAAGTTGG + Intergenic
933037071 2:77413246-77413268 GACCTAAAAAGAACATGAGTAGG + Intronic
933836774 2:86252166-86252188 GGCCCAGCAAGAACAAGGATTGG - Intronic
936276132 2:111099221-111099243 GGCCCCACAAGAGAAGGAGTTGG + Intronic
940767988 2:157810440-157810462 GGCCCAATAAGAACTTGAGAAGG + Intronic
941964978 2:171292090-171292112 GGCCCAAGAAGAACACCATTTGG + Intergenic
946904405 2:224402160-224402182 GGCCGAAAAGGAACATGAGTTGG + Intergenic
1169604941 20:7306773-7306795 GGCCCAAGAATAATAAGAATGGG - Intergenic
1172663151 20:36581101-36581123 TGGGCAACAAGAACAAGACTCGG + Intronic
1172767635 20:37359195-37359217 GGCCCCACAGGAATAAGAGGTGG - Intronic
1175300409 20:57938848-57938870 GACCCAAAATGAACAAGACTAGG - Intergenic
1175629469 20:60522485-60522507 GAGCCAAAAAGAACACGAGTAGG - Intergenic
1181693677 22:24582108-24582130 GGCCCAACATGACCAAGACTCGG - Intronic
1185010043 22:48307725-48307747 GGCCCAAGAGGAGCAAGATTCGG + Intergenic
952803972 3:37328491-37328513 GGCACAAAAGGAACAAGAGCTGG + Exonic
953901284 3:46845612-46845634 GTTCCAAAAGGAACAAGAGTGGG + Intergenic
954322646 3:49842490-49842512 GACCAAACAAGCACAAGAGGAGG - Exonic
957674673 3:83351126-83351148 GGCCCAACAACAACCTGTGTTGG + Intergenic
957761795 3:84568256-84568278 TGTCCAACCAGATCAAGAGTGGG + Intergenic
959853589 3:111120856-111120878 GGGCCAAGAAGAAAAAGAGTAGG - Intronic
962594625 3:136928043-136928065 GGCCCAACAAGAACAAGAGTTGG + Exonic
963608311 3:147433439-147433461 GCCACGAAAAGAACAAGAGTAGG + Intronic
965764930 3:172120423-172120445 GGCACAGCATGAACAAGAGAGGG - Intronic
966421113 3:179735233-179735255 GACCCAACTTGACCAAGAGTCGG - Intronic
967996993 3:195174300-195174322 GTCCTAAGAAGAAAAAGAGTAGG - Intronic
968933979 4:3600354-3600376 GGCAGAACAAGAACAGGAGGTGG + Intergenic
975289362 4:72658853-72658875 GGCTCAAAAAGAACAGGAGCTGG + Intergenic
975394309 4:73857114-73857136 TGCCCACCAAGATTAAGAGTGGG - Intergenic
975410640 4:74044949-74044971 AGCCTAACAAGATCAGGAGTTGG + Intergenic
977831494 4:101599241-101599263 GGCCCAACAAAAAAAACAGACGG - Intronic
978505467 4:109451550-109451572 GGCCAAACAACAAAAAGATTGGG - Intronic
978867951 4:113537826-113537848 GGCAAAATAATAACAAGAGTTGG + Intronic
979744468 4:124194059-124194081 GGCCCAAGAAGAGAAAGAGATGG + Intergenic
984748551 4:183248887-183248909 GGCCCATCAAGGACAACACTGGG - Intronic
988642715 5:33059126-33059148 GGCCAAAAAAGAAAAAGAGCAGG + Intergenic
988879229 5:35482394-35482416 GGCCTAAATAGAACAAGAATTGG + Intergenic
991123509 5:63043625-63043647 GACCCTACAAGAATAAGACTGGG + Intergenic
995788101 5:115853127-115853149 TAACCAACAATAACAAGAGTTGG - Intronic
998732396 5:145094459-145094481 TGCCCACCAAGAACAAGACAAGG + Intergenic
1001810766 5:174626580-174626602 GGCCCAACAAGTGCAAGACATGG + Intergenic
1004735961 6:18406701-18406723 GGCCTAAAAAGAACAAAAGGAGG - Intronic
1005324926 6:24690738-24690760 AGGCCAAAAATAACAAGAGTTGG - Intronic
1006272646 6:32976099-32976121 GCCACAAGAAGAACAAGAGCTGG + Exonic
1007473109 6:42103581-42103603 GGCCCAGGAAGACCGAGAGTGGG - Exonic
1008407832 6:51138885-51138907 GGACCAAGAGGAACAGGAGTGGG - Intergenic
1011176789 6:84570770-84570792 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1012656652 6:101831655-101831677 TGACCAACAAGAACAATAATAGG - Intronic
1012747833 6:103117228-103117250 GGCCCAAACAGAACAAGAGGTGG + Intergenic
1014866053 6:126531857-126531879 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1021509359 7:21418544-21418566 GGCCCCACAAAAATATGAGTGGG + Intergenic
1022017007 7:26358827-26358849 GGGCCAACAACAGCAAGACTTGG - Intronic
1031653101 7:124316045-124316067 GGAGCACCAAGAACAAGAGAAGG + Intergenic
1033742131 7:144283862-144283884 GGGCCAACAAGCACAAGGGCTGG - Intergenic
1033751771 7:144365752-144365774 GGGCCAACAAGCACAAGGGCTGG + Exonic
1034782054 7:153889268-153889290 GGCTAAAAAAGAAAAAGAGTGGG - Intronic
1035007536 7:155678064-155678086 GTACCATCAAGAACAGGAGTGGG + Intronic
1035525401 8:308628-308650 GGCACACCAAGAACAAGAGCTGG - Intergenic
1035626831 8:1076944-1076966 GGCCCCCCAAGACCAAGAGGGGG + Intergenic
1041507120 8:58611517-58611539 GGGTCAACAAGAACAAAAGATGG + Intronic
1042592149 8:70406116-70406138 GTACAAACAAGAACAAGACTAGG - Intergenic
1044514470 8:93122247-93122269 AGTCCAATAAGAAAAAGAGTTGG - Intergenic
1045232940 8:100322792-100322814 GGCCCAAGAAGAGGAAGAGATGG + Intronic
1046586640 8:116156068-116156090 GGCCCAACAAGAAAAATTCTGGG + Intergenic
1049334244 8:142074293-142074315 GGCCCAGCAACAACAAGACCAGG + Intergenic
1054456176 9:65431625-65431647 GGCAGAACAAGAACAGGAGGTGG - Intergenic
1056242070 9:84657717-84657739 AGCCCAAAAAGAGAAAGAGTAGG - Intergenic
1057477692 9:95417296-95417318 GGACCAACAAGGTCAAAAGTTGG + Intergenic
1058001670 9:99872182-99872204 GGCCAACCAAGAAGTAGAGTTGG + Intergenic
1061939201 9:133875020-133875042 GCCCCAGAAAGAACAAGGGTGGG + Intronic
1187221512 X:17331082-17331104 GTCCCAAGAATAACAAGAGAGGG + Intergenic
1190451842 X:50589931-50589953 AGCCAAACAATAACAAGTGTTGG - Intergenic
1190528186 X:51348973-51348995 AGCCCAACAATAACAAGATGAGG + Intergenic
1193793534 X:85845518-85845540 GGACCAACAAGACAAAAAGTTGG + Intergenic
1198201691 X:134426672-134426694 AGCCCTACAAGAAGAAAAGTAGG - Exonic
1199324114 X:146476814-146476836 GGCCCAACGAGAAGCAGGGTTGG + Intergenic
1199818673 X:151423188-151423210 GGCCAAACCAGAACTACAGTTGG + Intergenic
1199922174 X:152418709-152418731 GGCCCAGCAAATACAAAAGTTGG + Intronic