ID: 962596637

View in Genome Browser
Species Human (GRCh38)
Location 3:136953006-136953028
Sequence CAGTAATCATTGAGTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962596637 Original CRISPR CAGTAATCATTGAGTAAGGA TGG Intronic
903528823 1:24013829-24013851 CAGTAATAATGGAGTAGGGTGGG + Intergenic
905111251 1:35596059-35596081 CAGTAATCATTCTGTAGAGAGGG - Intergenic
905286216 1:36882100-36882122 CAGTGATCATTTAATAAAGAAGG - Intronic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
907561133 1:55389271-55389293 CAGAAATCATTTAGTGAGAAGGG + Intergenic
912119119 1:106447785-106447807 CAGGAAACAGTGAGTAAGAATGG + Intergenic
913003678 1:114607074-114607096 CAGTAGTCACTGAGTAGGGGTGG + Intronic
913284164 1:117211885-117211907 GAGCAACCATTGAGTAAAGATGG + Intergenic
913555935 1:119967251-119967273 CCTTACTCTTTGAGTAAGGAAGG + Intronic
915810211 1:158900993-158901015 CTGTAATCAGTTTGTAAGGAAGG - Intergenic
918234358 1:182564446-182564468 CAGAAATCATTGAGAATGGCAGG - Intergenic
918325989 1:183411234-183411256 CAGGAATGATAGAGTCAGGAAGG - Intronic
921999851 1:221465624-221465646 CAGTATTTTTTGTGTAAGGAAGG + Intergenic
922472359 1:225884088-225884110 CACCATTCATTGAGGAAGGAAGG - Intergenic
923861272 1:237894322-237894344 CAGTAATTAGGGAGCAAGGATGG + Intergenic
1065449683 10:25843891-25843913 CATTAATCATTGATAAAGAAGGG - Intergenic
1065490623 10:26278365-26278387 CAGTAAGCATTAAATAAGGTTGG - Intronic
1066022243 10:31315667-31315689 CTGCAGTCATTGAGTCAGGAAGG - Intergenic
1069379150 10:67824332-67824354 CAGTTATCCTTGAGTAATGGTGG - Intronic
1070556673 10:77533374-77533396 ATGTAATCATTGACTAGGGAAGG - Intronic
1073961820 10:108940080-108940102 CAGATATCATTGTGTAAGGGTGG + Intergenic
1074209557 10:111317650-111317672 CAGTTTTCCTTGAGCAAGGAAGG + Intergenic
1075565942 10:123504373-123504395 CAGTAATAATTGCGTAAGCAAGG + Intergenic
1077947282 11:6914197-6914219 CTGTAATCTTTGAGTGAGAAAGG - Intergenic
1078735511 11:14016189-14016211 TAGTAAACACTGAGAAAGGAAGG - Intronic
1080307928 11:30856763-30856785 CAGTATTAAATGAGTAAAGAAGG + Intronic
1081027854 11:38037528-38037550 CAGTAATAAGTGAGTGAGGTGGG + Intergenic
1083237216 11:61358916-61358938 CAGTAATCTCTGAGAAAGGAAGG + Intronic
1083454915 11:62772056-62772078 AAGTAAGCACTGAGTAAGTAGGG - Intronic
1084246636 11:67862159-67862181 AAGTCATCCTGGAGTAAGGAGGG + Intergenic
1086391760 11:86372116-86372138 CATAAATCCTTGAGTAAGCAAGG + Intergenic
1086872067 11:92049667-92049689 CAGTGATTATTGAACAAGGATGG + Intergenic
1086941852 11:92806648-92806670 CAGCAAACATTCAGAAAGGATGG - Intronic
1087647434 11:100824736-100824758 CACAAATCATGGAGTAGGGAGGG - Intronic
1088515671 11:110630545-110630567 CAGTAAGCATTGAGTAGAAAGGG + Intronic
1091498873 12:995848-995870 AAGAAATCATTGAGTTAGGAGGG + Intronic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1093746132 12:22742666-22742688 CAGTAATCAGTGAGCAAAGCAGG - Intergenic
1094083503 12:26563644-26563666 CAGTAAATGTTAAGTAAGGAGGG - Intronic
1094586275 12:31780604-31780626 CAGAAATCAATGAGAAAGGTTGG - Intergenic
1095498985 12:42815900-42815922 AAGTAACCCTTGAGTAGGGAAGG + Intergenic
1095582249 12:43813698-43813720 CAACAGTCACTGAGTAAGGAAGG - Intergenic
1099089731 12:78291102-78291124 CATTAATCATTGAGTACTAATGG + Intergenic
1100099566 12:91086987-91087009 CTGTAATTATGGTGTAAGGAAGG + Intergenic
1100598693 12:96093592-96093614 CAGGCTTCATTGAGCAAGGAGGG + Intergenic
1101238235 12:102811774-102811796 CAGTACTCATTAAGGAAGAAAGG + Intergenic
1103426062 12:120835205-120835227 CAGTTATCACTCAGAAAGGAAGG + Intronic
1105727066 13:23174099-23174121 CAATAATTATTCAGAAAGGAGGG - Intergenic
1107015327 13:35704323-35704345 CAGTAATCATTGTTTCAGGCAGG - Intergenic
1108893748 13:55296059-55296081 TAGTAATCATTCAGTAAATATGG + Intergenic
1110456076 13:75691815-75691837 CAGTCTTCACTGAGTAAAGAGGG - Intronic
1111554163 13:89858085-89858107 CTGTAATCATTGAGGAAGACAGG + Intergenic
1112402561 13:99088104-99088126 AAGTAATTATTGAGTGCGGACGG - Intergenic
1115062895 14:29215362-29215384 AAGAAATGATTGAGAAAGGAAGG - Intergenic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1115505441 14:34089458-34089480 CAGAAAACCTTGAGTAAGGTTGG + Intronic
1115542828 14:34438756-34438778 CATTTATCATTGATTAAGGTTGG - Intronic
1116585975 14:46705049-46705071 CAGTAATCATTCTGTATGAATGG + Intergenic
1118858506 14:69643101-69643123 CAGTAATCCTTGAGAAATGGGGG - Intronic
1119952114 14:78755755-78755777 GAGAAATGCTTGAGTAAGGAAGG - Intronic
1120593826 14:86408813-86408835 GAGTTTTCATTGAATAAGGAGGG + Intergenic
1121363540 14:93285947-93285969 CAGTAAACATGGACTAAGGAAGG + Intronic
1121601155 14:95203967-95203989 AAGGAATCATTGAGGCAGGATGG - Exonic
1122496263 14:102158010-102158032 CTGAAAACATTGAGAAAGGAAGG - Intronic
1123888880 15:24755651-24755673 CAGTAATCATTGTGTAATTGTGG - Intergenic
1123925620 15:25107408-25107430 CAGGAATCATTCAGTTGGGAAGG + Intergenic
1125960487 15:43825955-43825977 CAGTAATTTTTGAGTCATGAGGG + Intergenic
1126692380 15:51297655-51297677 CAGTAGGCATTGAGCAGGGAGGG - Intronic
1127293555 15:57591339-57591361 CAGTAATCATTGAATAAATATGG + Intergenic
1127351548 15:58157854-58157876 CAGTCATCTCTGAGAAAGGAAGG + Intronic
1128553731 15:68615902-68615924 CAGTAAGCATCTAGGAAGGAAGG - Intronic
1130084263 15:80764130-80764152 CAGAGCTCTTTGAGTAAGGAGGG + Intergenic
1130620813 15:85460458-85460480 CAATAAACATGGAGCAAGGAAGG - Intronic
1131250460 15:90826975-90826997 CAGTAACCGTGGAGTAAGGTGGG - Intergenic
1131607486 15:93922734-93922756 CAGAAATCATGGAGCAAAGAAGG + Intergenic
1133408177 16:5543047-5543069 AATTAATCATAGAGTAAGCATGG + Intergenic
1133707566 16:8369657-8369679 CAGTAATTAATGAATAAAGATGG - Intergenic
1133825398 16:9273764-9273786 CATTAATGATTGAGTCAGGATGG - Intergenic
1135571997 16:23556885-23556907 CAGTGATCATTGAGAAAGGTAGG - Intronic
1137327202 16:47452723-47452745 CACTAATTATGGAGTAAGTATGG - Exonic
1138137133 16:54532848-54532870 CAGTAGTCAGTGAGCAAAGATGG + Intergenic
1138910697 16:61394963-61394985 CAATAATCATTGACTAGGAAAGG + Intergenic
1139728453 16:68921818-68921840 ATGTAATCAGTGAGTCAGGATGG - Intronic
1139816728 16:69680546-69680568 CAGTAATGATTGCCTAAGAATGG - Intronic
1141382922 16:83591869-83591891 AAGTAGTCATTGAATAAGAAGGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1156446340 18:37239797-37239819 CATTAATGAGTGAATAAGGAAGG - Intergenic
1160070421 18:75623272-75623294 CAAAAATCATAGAGTGAGGAGGG + Intergenic
1163656118 19:18546056-18546078 CGGAAATCACTGAGGAAGGAAGG + Intergenic
1168212896 19:54904465-54904487 CGCTAAACATTGGGTAAGGAGGG - Intergenic
926499181 2:13631892-13631914 CAGTAGTCAGTAAGTAATGAAGG + Intergenic
926861328 2:17312512-17312534 CAGTAATCATTGAAAAAGGTTGG + Intergenic
927258883 2:21066505-21066527 CATTACTCATTGAGTAATAAAGG - Intergenic
931114550 2:59150509-59150531 GAGTAATCAGAGAGTGAGGAGGG - Intergenic
933145153 2:78842895-78842917 AAGTAATCAATGAGAAAGGAAGG + Intergenic
934879333 2:97960235-97960257 CTGTAATCATTGACTCAGGCAGG - Intronic
934934268 2:98453257-98453279 CACTAATTATTGCGGAAGGAAGG + Intronic
939553825 2:143649685-143649707 CCACAATCATTGAATAAGGAAGG + Intronic
941643369 2:168013286-168013308 CACTTATCATTGAGAAAGTACGG - Intronic
942382244 2:175403952-175403974 CAGTAAACACTGAGTAAGTATGG - Intergenic
942503649 2:176618691-176618713 CATTAAGCATTGATCAAGGAAGG - Intergenic
943107283 2:183561156-183561178 CAGGTATCATTCAGTAAAGAAGG - Intergenic
946791758 2:223308057-223308079 CAATAATCTTTGTGTGAGGATGG + Intergenic
1170155331 20:13264056-13264078 AAGTTATCATTGGGTAACGAGGG - Intronic
1170600458 20:17837561-17837583 GAGTTATCATTGAGGAAGGCAGG - Intergenic
1175650367 20:60716323-60716345 AAGTAATAAGTGAGGAAGGAGGG + Intergenic
1178483064 21:32997100-32997122 CAGTAATCAATAAGTACTGAGGG + Intergenic
1183028488 22:35084360-35084382 CTGTAATCAGGGAGAAAGGACGG - Intronic
1184569948 22:45316334-45316356 CAGAAATCACTGAGCAAGGCTGG - Intronic
955708836 3:61757219-61757241 CGGTTATCATTGAGAAATGAGGG + Intronic
957763148 3:84586080-84586102 AATTAATCATTGTGAAAGGAGGG - Intergenic
962596637 3:136953006-136953028 CAGTAATCATTGAGTAAGGATGG + Intronic
963572860 3:147019508-147019530 GAGTAATCCTTGAGAAAAGAGGG - Intergenic
964387076 3:156159079-156159101 CTGTAATAATTGAGTCTGGAGGG + Intronic
966223058 3:177569617-177569639 CAATAATCTTTAAATAAGGAAGG - Intergenic
966266912 3:178057181-178057203 CAGTGGTCATTGATTAAAGAGGG - Intergenic
966485564 3:180465537-180465559 CTGTAATAATTGTGTCAGGAAGG - Intergenic
967327532 3:188256968-188256990 CAGTAATCCTTGAGGAAGTTAGG + Intronic
970432093 4:15998454-15998476 CAGTCTTCATTTAGTAAGTAGGG + Exonic
970472201 4:16390013-16390035 CAGTAATCAAGGAGAAATGAGGG - Intergenic
970701765 4:18749934-18749956 GAGTGGTCATGGAGTAAGGAAGG - Intergenic
971223322 4:24728984-24729006 CAGTAAACATTGAATAAGCCAGG - Intergenic
971264829 4:25088345-25088367 CAGTCCTCATAGAGCAAGGAGGG - Intergenic
971426091 4:26517090-26517112 TAGTAAAAATTGAGTAAGGGTGG - Intergenic
971777540 4:30986239-30986261 CAGTTATCATTTAGTAGGCAAGG - Intronic
973025386 4:45262627-45262649 CTGTAAATATTGAGTTAGGAAGG + Intergenic
975340877 4:73238594-73238616 GAGAAATGATGGAGTAAGGAGGG - Intronic
975616444 4:76251927-76251949 CAGGAAGCATTGAGGAGGGAAGG - Intronic
977164142 4:93674474-93674496 CACTAATCATTGATTACAGAAGG - Intronic
978995611 4:115147598-115147620 TACTAATCATTGATTATGGAAGG - Intergenic
979090734 4:116478774-116478796 CAGAAATCATTGAGTGATGAAGG + Intergenic
979592966 4:122501571-122501593 CAGTAAGAGTTGATTAAGGAGGG + Intergenic
979932483 4:126648275-126648297 CAGTAATCATTGAGAGATGATGG - Intergenic
980271300 4:130587428-130587450 AAATAATCATGGAGTAAGTAAGG + Intergenic
980793556 4:137651320-137651342 CAGGAGTGATTGAGTCAGGAGGG + Intergenic
983711463 4:170722137-170722159 AAGTAAACATTGAGTACGTATGG + Intergenic
985168272 4:187121188-187121210 CAGTAATCATTGTGGCAGGTAGG + Intergenic
988333213 5:29870270-29870292 AAGTTATAATTAAGTAAGGAGGG + Intergenic
989054269 5:37351743-37351765 CAGTAAGAATTGAGTAAGGCTGG - Intronic
989416304 5:41181282-41181304 CAGTAATCATGCAATAAGAAGGG - Intronic
989761459 5:45021410-45021432 CAGTATTAATTGAATAAGCACGG - Intergenic
989807986 5:45635531-45635553 AAGTAGACGTTGAGTAAGGAAGG - Intronic
990490436 5:56298017-56298039 CAACACTCATTGAGTAAGCAGGG - Intergenic
993545959 5:89213149-89213171 CAGGTATCATGGAGTAAGGCAGG - Intergenic
994609403 5:102017897-102017919 CATTAATCATTGAGTAGTGCTGG + Intergenic
997979743 5:138461552-138461574 CTGTAGTGATTGAGTCAGGATGG - Intergenic
997989223 5:138530196-138530218 CAGAAACTATTGAGTCAGGATGG - Intronic
998468528 5:142364968-142364990 CAGGAAGCATCGAGGAAGGAAGG - Intergenic
998554072 5:143106100-143106122 AAGTAATCATTAAGTAAGGGTGG - Intronic
999689278 5:154132790-154132812 CAGCATTGATTGAGTGAGGAAGG + Intronic
1000164373 5:158633594-158633616 CAGAAATCTTTGGCTAAGGAGGG - Intergenic
1000353815 5:160374000-160374022 CAGTGATGAATGAATAAGGAAGG + Intergenic
1001437964 5:171715195-171715217 CAGTGAGCATTGACTTAGGAAGG + Intergenic
1003328810 6:5112628-5112650 CAGAAATCTCTGAGTCAGGAAGG + Intronic
1004351279 6:14892382-14892404 CAGAGAACAATGAGTAAGGATGG - Intergenic
1008138593 6:47805894-47805916 CTATAATCTCTGAGTAAGGATGG - Intronic
1013168063 6:107611309-107611331 CAGTAATCTTTCAGGAAGAAAGG + Intronic
1015623603 6:135157786-135157808 CAGTAATAATTGATGAATGAAGG - Intergenic
1016336550 6:143011513-143011535 CAGGAATCCATGAGAAAGGAAGG - Intergenic
1016366694 6:143326382-143326404 AAGAATTCATTGAGTAAAGATGG - Intronic
1016767823 6:147814912-147814934 GAGAAATCATGGAGAAAGGAAGG + Intergenic
1016930436 6:149401853-149401875 GAATAATCATTGAGTCAAGAAGG + Intronic
1020316535 7:6909349-6909371 CAGTACTCATTGATTTATGAGGG - Intergenic
1020655794 7:10926848-10926870 CAGCAATCAGTGGGCAAGGATGG + Intergenic
1028734916 7:94197853-94197875 GAGTAATCATTAACTAAGAAGGG + Intergenic
1028901684 7:96107919-96107941 CAGAAATCATTGAGGCCGGAAGG - Intronic
1030231353 7:107211011-107211033 CAGGAATCATTCAGTGAGTAGGG + Intronic
1031901533 7:127416651-127416673 CAGAAATCGGTGAGGAAGGAAGG + Intronic
1032502668 7:132411658-132411680 CAGTAAACATTGAGGAACAAAGG + Intronic
1034721357 7:153296705-153296727 CAATAATCATTGGGTAGGGTAGG - Intergenic
1036135666 8:6158948-6158970 CAGTGCTCATTGAGAAAGGCAGG + Intergenic
1037668539 8:20994881-20994903 CACATCTCATTGAGTAAGGAAGG + Intergenic
1040082800 8:43306056-43306078 CAGTAAGCACTGAATAAGGTAGG - Intergenic
1041495055 8:58476979-58477001 TAATAATAATTGAGTGAGGAGGG - Intergenic
1042574632 8:70204509-70204531 CTGTAATCCTTGTGCAAGGATGG + Intronic
1043486554 8:80703808-80703830 AAATAAGCATTAAGTAAGGATGG + Intronic
1044796534 8:95905159-95905181 CAATAATCATTAAGTAAGATTGG - Intergenic
1044815071 8:96103460-96103482 CTATAAGCATTGAGTAAGGAGGG - Intergenic
1045718334 8:105075092-105075114 CAATAAACATTGAAGAAGGAAGG - Intronic
1047886534 8:129256454-129256476 CAGCACTTAATGAGTAAGGAAGG + Intergenic
1048058683 8:130894633-130894655 CAGTAAGCATACAGTATGGATGG - Intronic
1052477650 9:28980970-28980992 AAGTAATTATTGAGGAAGGAGGG + Intergenic
1053559769 9:39179065-39179087 CAGTAAACATTGAGTAAAGCAGG + Intronic
1053823878 9:41999309-41999331 CAGTAAACATTGAGTAAAGCAGG + Intronic
1054137347 9:61439878-61439900 CAGTAAACATTGAGTAAAGCAGG - Intergenic
1054606694 9:67188058-67188080 CAGTAAACATTGAGTAAAGCAGG - Intergenic
1054752636 9:68923490-68923512 CAGTAATCACTTAGTAATTATGG + Intronic
1059220440 9:112611782-112611804 CTGAAATAATAGAGTAAGGAGGG + Intronic
1059907686 9:119006501-119006523 CAATAATCATTGAGCTAGGCTGG - Intergenic
1062225931 9:135450415-135450437 CTGTAGTCATTGAGTGAGGCAGG + Intergenic
1185734127 X:2484700-2484722 CAGAAATCACTGGGAAAGGACGG + Intronic
1186970134 X:14833044-14833066 AAATAATCATTGTGGAAGGAAGG - Intergenic
1187173786 X:16876543-16876565 CAGTAGTCATTGATGGAGGAAGG - Intergenic
1187544559 X:20235311-20235333 CAATACTCATGGGGTAAGGAGGG + Intronic
1191918943 X:66233218-66233240 AACTAATTATTGAGAAAGGATGG + Intronic
1192089607 X:68139988-68140010 AAATAATCACTGAGTAAAGAGGG + Intronic
1194729454 X:97436863-97436885 CAGTCATCATTGACAAAGTAGGG + Intronic
1196503337 X:116411255-116411277 CAGAAATCAATAAGTAAGGTTGG + Intergenic
1197333527 X:125182472-125182494 CAGTAATCATTGGTTATGGTGGG - Intergenic
1197826641 X:130597239-130597261 CATCATTCATTGAGTAGGGAGGG + Intergenic
1198623789 X:138544745-138544767 CAGCAATCATTTAGGGAGGAAGG + Intergenic
1199929117 X:152500516-152500538 CAGTAATCATACAGTAAAGAAGG - Intergenic