ID: 962598264

View in Genome Browser
Species Human (GRCh38)
Location 3:136969342-136969364
Sequence CAGCGCGATTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962598257_962598264 29 Left 962598257 3:136969290-136969312 CCCAGCCTCGTTGCCGCCTTGCA 0: 317
1: 1173
2: 1908
3: 1654
4: 702
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
962598259_962598264 24 Left 962598259 3:136969295-136969317 CCTCGTTGCCGCCTTGCAGTTTG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
962598260_962598264 16 Left 962598260 3:136969303-136969325 CCGCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
962598258_962598264 28 Left 962598258 3:136969291-136969313 CCAGCCTCGTTGCCGCCTTGCAG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
962598261_962598264 13 Left 962598261 3:136969306-136969328 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
962598256_962598264 30 Left 962598256 3:136969289-136969311 CCCCAGCCTCGTTGCCGCCTTGC 0: 316
1: 1145
2: 1873
3: 1683
4: 815
Right 962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962598264 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG Intronic
Too many off-targets to display for this crispr