ID: 962602354

View in Genome Browser
Species Human (GRCh38)
Location 3:137002837-137002859
Sequence TCAGGACATAGGCATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17280
Summary {0: 10218, 1: 5001, 2: 1235, 3: 356, 4: 470}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602354_962602363 14 Left 962602354 3:137002837-137002859 CCTTGCCCATGCCTATGTCCTGA 0: 10218
1: 5001
2: 1235
3: 356
4: 470
Right 962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG 0: 17
1: 979
2: 15216
3: 6154
4: 3042
962602354_962602364 21 Left 962602354 3:137002837-137002859 CCTTGCCCATGCCTATGTCCTGA 0: 10218
1: 5001
2: 1235
3: 356
4: 470
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602354_962602361 4 Left 962602354 3:137002837-137002859 CCTTGCCCATGCCTATGTCCTGA 0: 10218
1: 5001
2: 1235
3: 356
4: 470
Right 962602361 3:137002864-137002886 TATTGCCTAGGTTTTCTTCTAGG 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
962602354_962602359 -8 Left 962602354 3:137002837-137002859 CCTTGCCCATGCCTATGTCCTGA 0: 10218
1: 5001
2: 1235
3: 356
4: 470
Right 962602359 3:137002852-137002874 TGTCCTGAATGGTATTGCCTAGG 0: 8513
1: 11095
2: 4149
3: 2051
4: 1564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602354 Original CRISPR TCAGGACATAGGCATGGGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr